Incidental Mutation 'R5665:Zfp346'
ID444371
Institutional Source Beutler Lab
Gene Symbol Zfp346
Ensembl Gene ENSMUSG00000021481
Gene Namezinc finger protein 346
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.375) question?
Stock #R5665 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location55105311-55134825 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55113102 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 81 (M81T)
Ref Sequence ENSEMBL: ENSMUSP00000124034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021937] [ENSMUST00000159147] [ENSMUST00000159278] [ENSMUST00000160660] [ENSMUST00000161315] [ENSMUST00000161551] [ENSMUST00000162428] [ENSMUST00000162476]
Predicted Effect probably benign
Transcript: ENSMUST00000021937
AA Change: M81T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000021937
Gene: ENSMUSG00000021481
AA Change: M81T

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
ZnF_U1 131 165 5.22e-7 SMART
ZnF_C2H2 134 158 4.98e-1 SMART
ZnF_U1 182 216 1.87e-8 SMART
ZnF_C2H2 185 209 1.51e1 SMART
ZnF_U1 236 270 1.99e-3 SMART
ZnF_C2H2 239 263 3.47e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159147
AA Change: M81T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124107
Gene: ENSMUSG00000021481
AA Change: M81T

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
Pfam:zf-met 73 96 3.3e-5 PFAM
ZnF_U1 99 133 5.22e-7 SMART
ZnF_C2H2 102 126 4.98e-1 SMART
ZnF_U1 150 184 1.87e-8 SMART
ZnF_C2H2 153 177 1.51e1 SMART
ZnF_U1 204 238 1.99e-3 SMART
ZnF_C2H2 207 231 3.47e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159278
AA Change: M81T

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125078
Gene: ENSMUSG00000021481
AA Change: M81T

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
ZnF_U1 131 165 5.22e-7 SMART
ZnF_C2H2 134 158 4.98e-1 SMART
ZnF_U1 198 232 1.87e-8 SMART
ZnF_C2H2 201 225 1.51e1 SMART
ZnF_U1 251 285 1.99e-3 SMART
ZnF_C2H2 254 278 3.47e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160660
AA Change: M81T

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124034
Gene: ENSMUSG00000021481
AA Change: M81T

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161018
SMART Domains Protein: ENSMUSP00000125154
Gene: ENSMUSG00000021481

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000161077
AA Change: M62T
SMART Domains Protein: ENSMUSP00000125204
Gene: ENSMUSG00000021481
AA Change: M62T

DomainStartEndE-ValueType
ZnF_U1 52 86 1.26e-5 SMART
ZnF_C2H2 55 79 2.61e1 SMART
ZnF_U1 113 147 5.22e-7 SMART
ZnF_C2H2 116 140 4.98e-1 SMART
ZnF_U1 180 214 1.87e-8 SMART
ZnF_C2H2 183 207 1.51e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161315
AA Change: M81T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124397
Gene: ENSMUSG00000021481
AA Change: M81T

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161551
AA Change: M81T

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124180
Gene: ENSMUSG00000021481
AA Change: M81T

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
PDB:1ZU1|A 53 93 4e-12 PDB
Blast:ZnF_U1 70 94 3e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162288
Predicted Effect probably benign
Transcript: ENSMUST00000162428
AA Change: M81T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000125389
Gene: ENSMUSG00000021481
AA Change: M81T

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162476
AA Change: M81T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000125743
Gene: ENSMUSG00000021481
AA Change: M81T

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleolar, zinc finger protein that preferentially binds to double-stranded (ds) RNA or RNA/DNA hybrids, rather than DNA alone. Mutational studies indicate that the zinc finger domains are not only essential for dsRNA binding, but are also required for its nucleolar localization. The encoded protein may be involved in cell growth and survival. It plays a role in protecting neurons by inhibiting cell cycle re-entry via stimulation of p21 gene expression. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Acaca G T 11: 84,245,294 E492* probably null Het
Acp7 T A 7: 28,616,543 K206M probably benign Het
Agbl1 T A 7: 76,589,503 F584I probably damaging Het
Ahi1 A G 10: 21,055,047 I929V possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arhgef40 A G 14: 52,000,900 I1279V possibly damaging Het
Arl14 A C 3: 69,223,038 T173P probably damaging Het
Asap1 A G 15: 64,312,453 S44P probably damaging Het
Btbd7 C A 12: 102,785,197 A1103S probably benign Het
Capn10 T A 1: 92,937,931 probably null Het
Capn7 T C 14: 31,369,802 F719L probably benign Het
Casp7 G A 19: 56,440,982 D267N probably benign Het
Ccdc13 C A 9: 121,814,290 K348N probably damaging Het
Chchd1 T C 14: 20,703,110 F13L probably benign Het
Clcn6 T A 4: 148,014,561 M442L possibly damaging Het
Col6a3 T C 1: 90,827,880 E229G probably benign Het
Cyb5r3 A G 15: 83,154,554 F278S probably damaging Het
Dhx16 C T 17: 35,891,086 Q1002* probably null Het
Dppa4 T C 16: 48,291,015 L121P probably benign Het
Dpyd A G 3: 118,917,092 E383G probably damaging Het
Eif4g3 A G 4: 138,126,589 T489A probably benign Het
Elovl1 G T 4: 118,431,635 V174L probably damaging Het
Elp3 T C 14: 65,551,402 K392E possibly damaging Het
Fancd2os C A 6: 113,598,024 W7L probably damaging Het
Fchsd2 A G 7: 101,110,784 T23A possibly damaging Het
Gabrp C G 11: 33,554,308 A336P possibly damaging Het
Gcm2 T A 13: 41,109,911 Y15F possibly damaging Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Herc1 A G 9: 66,465,435 E3091G probably damaging Het
Homer1 A T 13: 93,356,102 M184L probably benign Het
Izumo1r T C 9: 14,900,849 E117G probably damaging Het
Kcnt1 C T 2: 25,901,909 Q590* probably null Het
Lama1 G T 17: 67,770,987 C1139F probably damaging Het
Med29 C T 7: 28,386,814 A190T probably benign Het
Mgea5 A C 19: 45,776,997 S124A probably benign Het
Muc4 T C 16: 32,750,782 V220A probably benign Het
Mxra8 G T 4: 155,842,921 V388L probably benign Het
Myo5a T C 9: 75,144,181 probably null Het
Myrip A G 9: 120,461,433 Y706C probably damaging Het
Nphp4 T C 4: 152,506,485 V313A probably benign Het
Olfm2 T G 9: 20,668,544 probably null Het
Olfr1113 T A 2: 87,213,728 S279T probably benign Het
Olfr248 T C 1: 174,391,375 F102S probably damaging Het
Pcdh15 C T 10: 74,626,788 P1398L probably damaging Het
Pdpr A G 8: 111,114,811 E225G possibly damaging Het
Pigs C A 11: 78,328,769 probably null Het
Pkhd1 T A 1: 20,588,531 T159S probably damaging Het
Plk4 A G 3: 40,813,586 T87A possibly damaging Het
Plxna4 T C 6: 32,215,722 Y768C probably damaging Het
Prl3d3 T A 13: 27,159,081 probably null Het
Pygb T C 2: 150,820,888 probably null Het
Rnf114 T C 2: 167,510,934 I118T possibly damaging Het
Sbno2 A G 10: 80,058,453 L1099P probably benign Het
Scaper T C 9: 55,807,632 K791E probably damaging Het
Serping1 T C 2: 84,771,545 T194A probably damaging Het
Slc12a9 A G 5: 137,321,403 S617P possibly damaging Het
Slk G A 19: 47,636,457 R1039H probably damaging Het
Sntb1 T A 15: 55,792,139 E227V probably benign Het
Sostdc1 C A 12: 36,314,408 P39T probably benign Het
Spred1 C T 2: 117,153,005 R16* probably null Het
Srpk2 A G 5: 23,518,477 I547T probably damaging Het
Stt3a A G 9: 36,759,314 Y54H probably damaging Het
Stt3b A T 9: 115,266,147 L272H probably damaging Het
Syne2 T A 12: 76,108,217 probably null Het
Uso1 A T 5: 92,198,337 E793V possibly damaging Het
Usp15 A T 10: 123,130,987 L476* probably null Het
Vmn1r189 T C 13: 22,102,166 Y167C probably damaging Het
Vmn2r24 A G 6: 123,786,979 T272A possibly damaging Het
Vps13a A T 19: 16,668,690 H1994Q probably damaging Het
Zbtb10 T C 3: 9,265,192 S537P probably damaging Het
Zbtb12 T C 17: 34,895,883 S215P possibly damaging Het
Zfp800 T C 6: 28,244,513 D151G probably null Het
Other mutations in Zfp346
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0480:Zfp346 UTSW 13 55113097 nonsense probably null
R2025:Zfp346 UTSW 13 55132308 missense probably damaging 1.00
R2879:Zfp346 UTSW 13 55105350 missense possibly damaging 0.66
R4564:Zfp346 UTSW 13 55113707 missense probably damaging 1.00
R4821:Zfp346 UTSW 13 55113813 intron probably benign
R5647:Zfp346 UTSW 13 55122357 missense probably damaging 1.00
R6145:Zfp346 UTSW 13 55115574 missense probably damaging 0.98
R6450:Zfp346 UTSW 13 55113704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGGAGGTTTGTAAGCATAGC -3'
(R):5'- GCCCTAGCAAACACGTATGAAG -3'

Sequencing Primer
(F):5'- TTTGTAAGCATAGCAGGAGTCATG -3'
(R):5'- GGAAACATCTGGTAACTGTGC -3'
Posted On2016-11-09