Incidental Mutation 'R5665:Chchd1'
ID444373
Institutional Source Beutler Lab
Gene Symbol Chchd1
Ensembl Gene ENSMUSG00000063787
Gene Namecoiled-coil-helix-coiled-coil-helix domain containing 1
Synonyms1110001O19Rik, 2400010G13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.700) question?
Stock #R5665 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location20703006-20704425 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20703110 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 13 (F13L)
Ref Sequence ENSEMBL: ENSMUSP00000071202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022358] [ENSMUST00000048016] [ENSMUST00000071215] [ENSMUST00000223840] [ENSMUST00000224633] [ENSMUST00000224751] [ENSMUST00000226072]
Predicted Effect probably benign
Transcript: ENSMUST00000022358
SMART Domains Protein: ENSMUSP00000022358
Gene: ENSMUSG00000021819

DomainStartEndE-ValueType
low complexity region 50 66 N/A INTRINSIC
low complexity region 89 102 N/A INTRINSIC
low complexity region 390 405 N/A INTRINSIC
low complexity region 578 612 N/A INTRINSIC
low complexity region 736 751 N/A INTRINSIC
low complexity region 1000 1015 N/A INTRINSIC
low complexity region 1120 1135 N/A INTRINSIC
low complexity region 1176 1211 N/A INTRINSIC
low complexity region 1259 1270 N/A INTRINSIC
low complexity region 1343 1355 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1491 1511 N/A INTRINSIC
low complexity region 1527 1542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048016
SMART Domains Protein: ENSMUSP00000040370
Gene: ENSMUSG00000039357

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Glyco_tran_10_N 70 178 2.6e-12 PFAM
Pfam:Glyco_transf_10 204 403 2.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071215
AA Change: F13L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071202
Gene: ENSMUSG00000063787
AA Change: F13L

DomainStartEndE-ValueType
Pfam:CHCH 45 79 2.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180987
Predicted Effect probably benign
Transcript: ENSMUST00000223840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224165
Predicted Effect probably benign
Transcript: ENSMUST00000224633
Predicted Effect probably benign
Transcript: ENSMUST00000224751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225804
Predicted Effect unknown
Transcript: ENSMUST00000226072
AA Change: F13L
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Acaca G T 11: 84,245,294 E492* probably null Het
Acp7 T A 7: 28,616,543 K206M probably benign Het
Agbl1 T A 7: 76,589,503 F584I probably damaging Het
Ahi1 A G 10: 21,055,047 I929V possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arhgef40 A G 14: 52,000,900 I1279V possibly damaging Het
Arl14 A C 3: 69,223,038 T173P probably damaging Het
Asap1 A G 15: 64,312,453 S44P probably damaging Het
Btbd7 C A 12: 102,785,197 A1103S probably benign Het
Capn10 T A 1: 92,937,931 probably null Het
Capn7 T C 14: 31,369,802 F719L probably benign Het
Casp7 G A 19: 56,440,982 D267N probably benign Het
Ccdc13 C A 9: 121,814,290 K348N probably damaging Het
Clcn6 T A 4: 148,014,561 M442L possibly damaging Het
Col6a3 T C 1: 90,827,880 E229G probably benign Het
Cyb5r3 A G 15: 83,154,554 F278S probably damaging Het
Dhx16 C T 17: 35,891,086 Q1002* probably null Het
Dppa4 T C 16: 48,291,015 L121P probably benign Het
Dpyd A G 3: 118,917,092 E383G probably damaging Het
Eif4g3 A G 4: 138,126,589 T489A probably benign Het
Elovl1 G T 4: 118,431,635 V174L probably damaging Het
Elp3 T C 14: 65,551,402 K392E possibly damaging Het
Fancd2os C A 6: 113,598,024 W7L probably damaging Het
Fchsd2 A G 7: 101,110,784 T23A possibly damaging Het
Gabrp C G 11: 33,554,308 A336P possibly damaging Het
Gcm2 T A 13: 41,109,911 Y15F possibly damaging Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Herc1 A G 9: 66,465,435 E3091G probably damaging Het
Homer1 A T 13: 93,356,102 M184L probably benign Het
Izumo1r T C 9: 14,900,849 E117G probably damaging Het
Kcnt1 C T 2: 25,901,909 Q590* probably null Het
Lama1 G T 17: 67,770,987 C1139F probably damaging Het
Med29 C T 7: 28,386,814 A190T probably benign Het
Mgea5 A C 19: 45,776,997 S124A probably benign Het
Muc4 T C 16: 32,750,782 V220A probably benign Het
Mxra8 G T 4: 155,842,921 V388L probably benign Het
Myo5a T C 9: 75,144,181 probably null Het
Myrip A G 9: 120,461,433 Y706C probably damaging Het
Nphp4 T C 4: 152,506,485 V313A probably benign Het
Olfm2 T G 9: 20,668,544 probably null Het
Olfr1113 T A 2: 87,213,728 S279T probably benign Het
Olfr248 T C 1: 174,391,375 F102S probably damaging Het
Pcdh15 C T 10: 74,626,788 P1398L probably damaging Het
Pdpr A G 8: 111,114,811 E225G possibly damaging Het
Pigs C A 11: 78,328,769 probably null Het
Pkhd1 T A 1: 20,588,531 T159S probably damaging Het
Plk4 A G 3: 40,813,586 T87A possibly damaging Het
Plxna4 T C 6: 32,215,722 Y768C probably damaging Het
Prl3d3 T A 13: 27,159,081 probably null Het
Pygb T C 2: 150,820,888 probably null Het
Rnf114 T C 2: 167,510,934 I118T possibly damaging Het
Sbno2 A G 10: 80,058,453 L1099P probably benign Het
Scaper T C 9: 55,807,632 K791E probably damaging Het
Serping1 T C 2: 84,771,545 T194A probably damaging Het
Slc12a9 A G 5: 137,321,403 S617P possibly damaging Het
Slk G A 19: 47,636,457 R1039H probably damaging Het
Sntb1 T A 15: 55,792,139 E227V probably benign Het
Sostdc1 C A 12: 36,314,408 P39T probably benign Het
Spred1 C T 2: 117,153,005 R16* probably null Het
Srpk2 A G 5: 23,518,477 I547T probably damaging Het
Stt3a A G 9: 36,759,314 Y54H probably damaging Het
Stt3b A T 9: 115,266,147 L272H probably damaging Het
Syne2 T A 12: 76,108,217 probably null Het
Uso1 A T 5: 92,198,337 E793V possibly damaging Het
Usp15 A T 10: 123,130,987 L476* probably null Het
Vmn1r189 T C 13: 22,102,166 Y167C probably damaging Het
Vmn2r24 A G 6: 123,786,979 T272A possibly damaging Het
Vps13a A T 19: 16,668,690 H1994Q probably damaging Het
Zbtb10 T C 3: 9,265,192 S537P probably damaging Het
Zbtb12 T C 17: 34,895,883 S215P possibly damaging Het
Zfp346 T C 13: 55,113,102 M81T probably benign Het
Zfp800 T C 6: 28,244,513 D151G probably null Het
Other mutations in Chchd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Chchd1 APN 14 20703177 missense probably benign 0.01
IGL02234:Chchd1 APN 14 20703410 critical splice donor site probably null
R0047:Chchd1 UTSW 14 20704163 missense possibly damaging 0.73
R0047:Chchd1 UTSW 14 20704163 missense possibly damaging 0.73
R1575:Chchd1 UTSW 14 20703342 missense probably damaging 1.00
R2853:Chchd1 UTSW 14 20704220 missense probably benign
R6747:Chchd1 UTSW 14 20703380 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCATCCTAACCTGCTGTCG -3'
(R):5'- TCTCCGTGATACAGGTTGCCTC -3'

Sequencing Primer
(F):5'- TAACCTGCTGTCGGCTGC -3'
(R):5'- GATACAGGTTGCCTCTGGAG -3'
Posted On2016-11-09