Incidental Mutation 'R5665:Capn7'
ID444374
Institutional Source Beutler Lab
Gene Symbol Capn7
Ensembl Gene ENSMUSG00000021893
Gene Namecalpain 7
SynonymsPalBH
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.502) question?
Stock #R5665 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location31336638-31371986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31369802 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 719 (F719L)
Ref Sequence ENSEMBL: ENSMUSP00000022451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022451] [ENSMUST00000091903] [ENSMUST00000100730] [ENSMUST00000140002] [ENSMUST00000143472] [ENSMUST00000152182]
Predicted Effect probably benign
Transcript: ENSMUST00000022451
AA Change: F719L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000022451
Gene: ENSMUSG00000021893
AA Change: F719L

DomainStartEndE-ValueType
MIT 3 77 1.54e0 SMART
MIT 83 160 1.07e-17 SMART
CysPc 218 547 1.08e-91 SMART
Blast:CysPc 550 620 4e-39 BLAST
calpain_III 686 810 2.78e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091903
SMART Domains Protein: ENSMUSP00000089517
Gene: ENSMUSG00000021892

DomainStartEndE-ValueType
Pfam:SH3BP5 42 272 2.2e-99 PFAM
low complexity region 323 335 N/A INTRINSIC
low complexity region 407 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100730
SMART Domains Protein: ENSMUSP00000098296
Gene: ENSMUSG00000021892

DomainStartEndE-ValueType
Pfam:SH3BP5 60 274 5.5e-95 PFAM
low complexity region 321 333 N/A INTRINSIC
low complexity region 405 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140002
SMART Domains Protein: ENSMUSP00000117152
Gene: ENSMUSG00000021892

DomainStartEndE-ValueType
Pfam:SH3BP5 42 272 2.3e-99 PFAM
low complexity region 323 335 N/A INTRINSIC
low complexity region 407 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143472
SMART Domains Protein: ENSMUSP00000118596
Gene: ENSMUSG00000021893

DomainStartEndE-ValueType
MIT 3 77 1.54e0 SMART
MIT 83 160 1.07e-17 SMART
CysPc 218 500 2.32e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152182
SMART Domains Protein: ENSMUSP00000119214
Gene: ENSMUSG00000021893

DomainStartEndE-ValueType
MIT 3 77 1.54e0 SMART
MIT 83 160 1.07e-17 SMART
CysPc 218 500 2.32e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228237
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains are ubiquitous, well-conserved family of calcium-dependent, cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large subunit possesses a cysteine protease domain, and both subunits possess calcium-binding domains. Calpains have been implicated in neurodegenerative processes, as their activation can be triggered by calcium influx and oxidative stress. The function of the protein encoded by this gene is not known. An orthologue has been found in mouse but it seems to diverge from other family members. The mouse orthologue is thought to be calcium independent with protease activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene frequently die before weaning. Survivors display reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Acaca G T 11: 84,245,294 E492* probably null Het
Acp7 T A 7: 28,616,543 K206M probably benign Het
Agbl1 T A 7: 76,589,503 F584I probably damaging Het
Ahi1 A G 10: 21,055,047 I929V possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arhgef40 A G 14: 52,000,900 I1279V possibly damaging Het
Arl14 A C 3: 69,223,038 T173P probably damaging Het
Asap1 A G 15: 64,312,453 S44P probably damaging Het
Btbd7 C A 12: 102,785,197 A1103S probably benign Het
Capn10 T A 1: 92,937,931 probably null Het
Casp7 G A 19: 56,440,982 D267N probably benign Het
Ccdc13 C A 9: 121,814,290 K348N probably damaging Het
Chchd1 T C 14: 20,703,110 F13L probably benign Het
Clcn6 T A 4: 148,014,561 M442L possibly damaging Het
Col6a3 T C 1: 90,827,880 E229G probably benign Het
Cyb5r3 A G 15: 83,154,554 F278S probably damaging Het
Dhx16 C T 17: 35,891,086 Q1002* probably null Het
Dppa4 T C 16: 48,291,015 L121P probably benign Het
Dpyd A G 3: 118,917,092 E383G probably damaging Het
Eif4g3 A G 4: 138,126,589 T489A probably benign Het
Elovl1 G T 4: 118,431,635 V174L probably damaging Het
Elp3 T C 14: 65,551,402 K392E possibly damaging Het
Fancd2os C A 6: 113,598,024 W7L probably damaging Het
Fchsd2 A G 7: 101,110,784 T23A possibly damaging Het
Gabrp C G 11: 33,554,308 A336P possibly damaging Het
Gcm2 T A 13: 41,109,911 Y15F possibly damaging Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Herc1 A G 9: 66,465,435 E3091G probably damaging Het
Homer1 A T 13: 93,356,102 M184L probably benign Het
Izumo1r T C 9: 14,900,849 E117G probably damaging Het
Kcnt1 C T 2: 25,901,909 Q590* probably null Het
Lama1 G T 17: 67,770,987 C1139F probably damaging Het
Med29 C T 7: 28,386,814 A190T probably benign Het
Mgea5 A C 19: 45,776,997 S124A probably benign Het
Muc4 T C 16: 32,750,782 V220A probably benign Het
Mxra8 G T 4: 155,842,921 V388L probably benign Het
Myo5a T C 9: 75,144,181 probably null Het
Myrip A G 9: 120,461,433 Y706C probably damaging Het
Nphp4 T C 4: 152,506,485 V313A probably benign Het
Olfm2 T G 9: 20,668,544 probably null Het
Olfr1113 T A 2: 87,213,728 S279T probably benign Het
Olfr248 T C 1: 174,391,375 F102S probably damaging Het
Pcdh15 C T 10: 74,626,788 P1398L probably damaging Het
Pdpr A G 8: 111,114,811 E225G possibly damaging Het
Pigs C A 11: 78,328,769 probably null Het
Pkhd1 T A 1: 20,588,531 T159S probably damaging Het
Plk4 A G 3: 40,813,586 T87A possibly damaging Het
Plxna4 T C 6: 32,215,722 Y768C probably damaging Het
Prl3d3 T A 13: 27,159,081 probably null Het
Pygb T C 2: 150,820,888 probably null Het
Rnf114 T C 2: 167,510,934 I118T possibly damaging Het
Sbno2 A G 10: 80,058,453 L1099P probably benign Het
Scaper T C 9: 55,807,632 K791E probably damaging Het
Serping1 T C 2: 84,771,545 T194A probably damaging Het
Slc12a9 A G 5: 137,321,403 S617P possibly damaging Het
Slk G A 19: 47,636,457 R1039H probably damaging Het
Sntb1 T A 15: 55,792,139 E227V probably benign Het
Sostdc1 C A 12: 36,314,408 P39T probably benign Het
Spred1 C T 2: 117,153,005 R16* probably null Het
Srpk2 A G 5: 23,518,477 I547T probably damaging Het
Stt3a A G 9: 36,759,314 Y54H probably damaging Het
Stt3b A T 9: 115,266,147 L272H probably damaging Het
Syne2 T A 12: 76,108,217 probably null Het
Uso1 A T 5: 92,198,337 E793V possibly damaging Het
Usp15 A T 10: 123,130,987 L476* probably null Het
Vmn1r189 T C 13: 22,102,166 Y167C probably damaging Het
Vmn2r24 A G 6: 123,786,979 T272A possibly damaging Het
Vps13a A T 19: 16,668,690 H1994Q probably damaging Het
Zbtb10 T C 3: 9,265,192 S537P probably damaging Het
Zbtb12 T C 17: 34,895,883 S215P possibly damaging Het
Zfp346 T C 13: 55,113,102 M81T probably benign Het
Zfp800 T C 6: 28,244,513 D151G probably null Het
Other mutations in Capn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Capn7 APN 14 31363578 missense probably benign 0.41
IGL01481:Capn7 APN 14 31355339 missense probably damaging 1.00
IGL03231:Capn7 APN 14 31355290 missense probably damaging 1.00
R0018:Capn7 UTSW 14 31354112 nonsense probably null
R0018:Capn7 UTSW 14 31354112 nonsense probably null
R0060:Capn7 UTSW 14 31365604 splice site probably benign
R0060:Capn7 UTSW 14 31365604 splice site probably benign
R0077:Capn7 UTSW 14 31368115 missense probably benign 0.10
R0195:Capn7 UTSW 14 31365581 missense probably damaging 1.00
R0316:Capn7 UTSW 14 31347809 missense probably benign 0.00
R0815:Capn7 UTSW 14 31369757 missense possibly damaging 0.85
R0863:Capn7 UTSW 14 31369757 missense possibly damaging 0.85
R1697:Capn7 UTSW 14 31360160 missense probably damaging 1.00
R1954:Capn7 UTSW 14 31360150 missense probably damaging 1.00
R2096:Capn7 UTSW 14 31349887 critical splice donor site probably null
R3121:Capn7 UTSW 14 31359210 missense probably damaging 1.00
R3122:Capn7 UTSW 14 31359210 missense probably damaging 1.00
R4409:Capn7 UTSW 14 31355339 missense probably damaging 1.00
R4676:Capn7 UTSW 14 31359259 missense possibly damaging 0.72
R4799:Capn7 UTSW 14 31360557 missense probably benign 0.01
R5023:Capn7 UTSW 14 31352426 missense probably damaging 0.99
R5129:Capn7 UTSW 14 31344511 missense probably damaging 0.99
R5460:Capn7 UTSW 14 31368203 critical splice donor site probably null
R5608:Capn7 UTSW 14 31370707 missense probably damaging 1.00
R5786:Capn7 UTSW 14 31360145 missense probably damaging 1.00
R6186:Capn7 UTSW 14 31370918 missense probably damaging 1.00
R6190:Capn7 UTSW 14 31363603 missense probably benign 0.10
R6411:Capn7 UTSW 14 31340096 missense probably benign 0.00
R6514:Capn7 UTSW 14 31344554 missense probably benign 0.00
R6838:Capn7 UTSW 14 31354173 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAGTAAAGCAGCTTGTGTGGG -3'
(R):5'- GTAGTGCCATCATTATCCACACATC -3'

Sequencing Primer
(F):5'- GTGAAGACTTGACTGTCTGTGAC -3'
(R):5'- TGCCTAACATTCATGGGG -3'
Posted On2016-11-09