Incidental Mutation 'R5666:Hs2st1'
ID444406
Institutional Source Beutler Lab
Gene Symbol Hs2st1
Ensembl Gene ENSMUSG00000040151
Gene Nameheparan sulfate 2-O-sulfotransferase 1
SynonymsHs2st
MMRRC Submission 043309-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R5666 (G1)
Quality Score207
Status Not validated
Chromosome3
Chromosomal Location144429706-144570181 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 144569793 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 22 (V22E)
Ref Sequence ENSEMBL: ENSMUSP00000123816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043325] [ENSMUST00000082437] [ENSMUST00000106211] [ENSMUST00000160690]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043325
AA Change: V22E

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000043066
Gene: ENSMUSG00000040151
AA Change: V22E

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
Pfam:Sulfotransfer_2 66 327 9.1e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082437
SMART Domains Protein: ENSMUSP00000046910
Gene: ENSMUSG00000037072

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
Pfam:Sep15_SelM 85 160 2.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106211
SMART Domains Protein: ENSMUSP00000101817
Gene: ENSMUSG00000037072

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144859
Predicted Effect probably damaging
Transcript: ENSMUST00000160690
AA Change: V22E

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123816
Gene: ENSMUSG00000040151
AA Change: V22E

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199680
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biologic activities. This gene encodes a member of the heparan sulfate biosynthetic enzyme family that transfers sulfate to the 2 position of the iduronic acid residue of heparan sulfate. The disruption of this gene resulted in no kidney formation in knockout embryonic mice, indicating that the absence of this enzyme may interfere with the signaling required for kidney formation. Two alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: A mutation in this gene causes bilateral renal agenesis, bone defects, eye development abnormalities and cataracts in homozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik T C 5: 99,979,209 probably benign Het
Abce1 C A 8: 79,690,277 E368D probably benign Het
Bmper T A 9: 23,473,463 M588K probably damaging Het
Bop1 T C 15: 76,454,233 E503G probably benign Het
Btla A T 16: 45,250,419 D247V probably damaging Het
Cap2 T A 13: 46,531,083 probably null Het
Chd2 A T 7: 73,441,717 I1592K probably benign Het
Chd3 T C 11: 69,353,351 E1202G possibly damaging Het
Cmya5 T C 13: 93,045,949 I3568V possibly damaging Het
Col4a4 A G 1: 82,485,579 probably null Het
Cpxm2 C T 7: 132,054,896 E546K probably benign Het
Cyp2j5 C T 4: 96,658,693 V195I probably benign Het
Ddb2 C T 2: 91,212,581 V353M probably damaging Het
Dscam G A 16: 96,718,164 T791I probably benign Het
Dtd2 T A 12: 51,999,860 L65F probably damaging Het
E2f1 T A 2: 154,569,181 probably benign Het
Ephb3 A G 16: 21,222,491 N732S probably benign Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Foxm1 C T 6: 128,373,167 S339L possibly damaging Het
Fzd6 A T 15: 39,031,115 R225S probably benign Het
Gfpt1 A T 6: 87,053,813 I60F possibly damaging Het
Glce A G 9: 62,060,511 S453P probably damaging Het
Gm38100 C T 1: 175,921,613 T415M probably damaging Het
Gm4787 G A 12: 81,378,031 T451I probably benign Het
Hspa9 T C 18: 34,954,247 I2V probably null Het
Ikzf2 A G 1: 69,577,900 V96A probably benign Het
Ilkap T C 1: 91,391,141 T38A probably benign Het
Lpin3 A G 2: 160,897,330 T353A probably benign Het
Myh1 T A 11: 67,221,352 I1744N probably benign Het
Nadsyn1 C T 7: 143,807,431 G335S probably damaging Het
Ndc1 T C 4: 107,389,526 V382A possibly damaging Het
Ndufaf4 A T 4: 24,898,636 D64V probably damaging Het
Nfe2l2 T C 2: 75,677,118 T213A probably benign Het
Nkain4 A G 2: 180,943,202 L73P probably damaging Het
Nmt1 C T 11: 103,058,215 R299* probably null Het
Olfr1271 T C 2: 90,265,964 I155M probably benign Het
Olfr1373 A C 11: 52,144,698 Y277* probably null Het
Olfr173 G A 16: 58,797,061 P262S possibly damaging Het
Olfr352 T A 2: 36,870,389 D274E probably benign Het
Padi2 G T 4: 140,949,231 R560L possibly damaging Het
Palmd T C 3: 116,924,101 N249S possibly damaging Het
Pde1c A C 6: 56,126,857 probably null Het
Pdgfra T C 5: 75,173,495 S410P probably benign Het
Phldb1 T C 9: 44,715,781 M456V probably damaging Het
Pla2g2d T A 4: 138,780,280 C82S probably damaging Het
Rgs21 A G 1: 144,536,942 V48A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Slc4a2 G T 5: 24,434,838 V506L probably damaging Het
Slc7a4 A G 16: 17,575,951 probably benign Het
Sptbn5 C G 2: 120,085,567 probably benign Het
Sstr2 T A 11: 113,624,713 W153R probably damaging Het
Steap2 C T 5: 5,673,681 V400I probably benign Het
Syne2 G A 12: 75,950,959 G2236D probably benign Het
Tas2r130 T C 6: 131,630,379 N151S possibly damaging Het
Tex52 T C 6: 128,375,555 S13P probably benign Het
Tmprss13 A G 9: 45,344,955 I456V probably damaging Het
Trim24 T C 6: 37,965,601 F946S probably benign Het
Vmn2r10 A T 5: 108,999,044 Y459* probably null Het
Vwa1 A G 4: 155,774,465 L13P probably damaging Het
Zfp648 C A 1: 154,204,217 Q41K probably benign Het
Other mutations in Hs2st1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0037:Hs2st1 UTSW 3 144437644 nonsense probably null
R1215:Hs2st1 UTSW 3 144465141 missense possibly damaging 0.75
R1450:Hs2st1 UTSW 3 144434718 splice site probably benign
R1474:Hs2st1 UTSW 3 144435495 missense possibly damaging 0.94
R1505:Hs2st1 UTSW 3 144434561 missense probably benign 0.19
R1695:Hs2st1 UTSW 3 144434654 missense probably benign 0.00
R2511:Hs2st1 UTSW 3 144569930 unclassified probably benign
R2967:Hs2st1 UTSW 3 144465138 missense probably damaging 1.00
R3928:Hs2st1 UTSW 3 144434628 missense possibly damaging 0.55
R4895:Hs2st1 UTSW 3 144465253 missense probably benign
R4911:Hs2st1 UTSW 3 144465082 missense probably benign 0.23
R5477:Hs2st1 UTSW 3 144556948 critical splice donor site probably benign
R6262:Hs2st1 UTSW 3 144434613 missense probably damaging 0.96
X0019:Hs2st1 UTSW 3 144454012 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCTCTCAGTGAAGGGCCGAC -3'
(R):5'- TGAACACCACTGTACCGGAG -3'

Sequencing Primer
(F):5'- CGCGTGCAGCTCATCAG -3'
(R):5'- AGAAGCGTGCACCAGGC -3'
Posted On2016-11-09