Incidental Mutation 'R5666:Gfpt1'
ID444423
Institutional Source Beutler Lab
Gene Symbol Gfpt1
Ensembl Gene ENSMUSG00000029992
Gene Nameglutamine fructose-6-phosphate transaminase 1
SynonymsGFA, 2810423A18Rik, GFAT, GFAT1
MMRRC Submission 043309-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R5666 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location87042846-87092197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87053813 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 60 (I60F)
Ref Sequence ENSEMBL: ENSMUSP00000109288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032057] [ENSMUST00000113655] [ENSMUST00000113657] [ENSMUST00000113658]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032057
AA Change: I60F

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032057
Gene: ENSMUSG00000029992
AA Change: I60F

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
Pfam:GATase_6 69 213 1e-18 PFAM
Pfam:GATase_4 78 198 2.7e-7 PFAM
Pfam:GATase_7 93 195 2.1e-14 PFAM
Pfam:SIS 378 507 4.5e-38 PFAM
Pfam:SIS 549 680 1.6e-33 PFAM
Predicted Effect silent
Transcript: ENSMUST00000113655
SMART Domains Protein: ENSMUSP00000109285
Gene: ENSMUSG00000029992

DomainStartEndE-ValueType
Pfam:GATase_2 2 65 7.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113657
AA Change: I60F

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000109287
Gene: ENSMUSG00000029992
AA Change: I60F

DomainStartEndE-ValueType
Pfam:GATase_2 2 80 1.7e-10 PFAM
Pfam:GATase_2 76 120 9.5e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113658
AA Change: I60F

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109288
Gene: ENSMUSG00000029992
AA Change: I60F

DomainStartEndE-ValueType
Pfam:GATase_2 2 78 9e-9 PFAM
Pfam:GATase_4 63 191 3.2e-10 PFAM
Pfam:GATase_6 68 211 3.7e-20 PFAM
Pfam:GATase_2 76 220 6.4e-22 PFAM
Pfam:GATase_7 93 194 1.7e-15 PFAM
Pfam:SIS 362 491 4.5e-36 PFAM
Pfam:SIS 533 664 2.3e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150410
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the first and rate-limiting enzyme of the hexosamine pathway and controls the flux of glucose into the hexosamine pathway. The product of this gene catalyzes the formation of glucosamine 6-phosphate. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik T C 5: 99,979,209 probably benign Het
Abce1 C A 8: 79,690,277 E368D probably benign Het
Bmper T A 9: 23,473,463 M588K probably damaging Het
Bop1 T C 15: 76,454,233 E503G probably benign Het
Btla A T 16: 45,250,419 D247V probably damaging Het
Cap2 T A 13: 46,531,083 probably null Het
Chd2 A T 7: 73,441,717 I1592K probably benign Het
Chd3 T C 11: 69,353,351 E1202G possibly damaging Het
Cmya5 T C 13: 93,045,949 I3568V possibly damaging Het
Col4a4 A G 1: 82,485,579 probably null Het
Cpxm2 C T 7: 132,054,896 E546K probably benign Het
Cyp2j5 C T 4: 96,658,693 V195I probably benign Het
Ddb2 C T 2: 91,212,581 V353M probably damaging Het
Dscam G A 16: 96,718,164 T791I probably benign Het
Dtd2 T A 12: 51,999,860 L65F probably damaging Het
E2f1 T A 2: 154,569,181 probably benign Het
Ephb3 A G 16: 21,222,491 N732S probably benign Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Foxm1 C T 6: 128,373,167 S339L possibly damaging Het
Fzd6 A T 15: 39,031,115 R225S probably benign Het
Glce A G 9: 62,060,511 S453P probably damaging Het
Gm38100 C T 1: 175,921,613 T415M probably damaging Het
Gm4787 G A 12: 81,378,031 T451I probably benign Het
Hs2st1 A T 3: 144,569,793 V22E probably damaging Het
Hspa9 T C 18: 34,954,247 I2V probably null Het
Ikzf2 A G 1: 69,577,900 V96A probably benign Het
Ilkap T C 1: 91,391,141 T38A probably benign Het
Lpin3 A G 2: 160,897,330 T353A probably benign Het
Myh1 T A 11: 67,221,352 I1744N probably benign Het
Nadsyn1 C T 7: 143,807,431 G335S probably damaging Het
Ndc1 T C 4: 107,389,526 V382A possibly damaging Het
Ndufaf4 A T 4: 24,898,636 D64V probably damaging Het
Nfe2l2 T C 2: 75,677,118 T213A probably benign Het
Nkain4 A G 2: 180,943,202 L73P probably damaging Het
Nmt1 C T 11: 103,058,215 R299* probably null Het
Olfr1271 T C 2: 90,265,964 I155M probably benign Het
Olfr1373 A C 11: 52,144,698 Y277* probably null Het
Olfr173 G A 16: 58,797,061 P262S possibly damaging Het
Olfr352 T A 2: 36,870,389 D274E probably benign Het
Padi2 G T 4: 140,949,231 R560L possibly damaging Het
Palmd T C 3: 116,924,101 N249S possibly damaging Het
Pde1c A C 6: 56,126,857 probably null Het
Pdgfra T C 5: 75,173,495 S410P probably benign Het
Phldb1 T C 9: 44,715,781 M456V probably damaging Het
Pla2g2d T A 4: 138,780,280 C82S probably damaging Het
Rgs21 A G 1: 144,536,942 V48A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Slc4a2 G T 5: 24,434,838 V506L probably damaging Het
Slc7a4 A G 16: 17,575,951 probably benign Het
Sptbn5 C G 2: 120,085,567 probably benign Het
Sstr2 T A 11: 113,624,713 W153R probably damaging Het
Steap2 C T 5: 5,673,681 V400I probably benign Het
Syne2 G A 12: 75,950,959 G2236D probably benign Het
Tas2r130 T C 6: 131,630,379 N151S possibly damaging Het
Tex52 T C 6: 128,375,555 S13P probably benign Het
Tmprss13 A G 9: 45,344,955 I456V probably damaging Het
Trim24 T C 6: 37,965,601 F946S probably benign Het
Vmn2r10 A T 5: 108,999,044 Y459* probably null Het
Vwa1 A G 4: 155,774,465 L13P probably damaging Het
Zfp648 C A 1: 154,204,217 Q41K probably benign Het
Other mutations in Gfpt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Gfpt1 APN 6 87056163 missense probably damaging 1.00
IGL00946:Gfpt1 APN 6 87050942 missense probably damaging 1.00
IGL01083:Gfpt1 APN 6 87054696 missense probably damaging 1.00
IGL01930:Gfpt1 APN 6 87059415 missense possibly damaging 0.88
IGL02113:Gfpt1 APN 6 87087367 missense probably benign 0.04
IGL02724:Gfpt1 APN 6 87056182 nonsense probably null
IGL03024:Gfpt1 APN 6 87053831 missense probably damaging 1.00
R0829:Gfpt1 UTSW 6 87053865 splice site probably benign
R1779:Gfpt1 UTSW 6 87077197 missense possibly damaging 0.74
R1982:Gfpt1 UTSW 6 87054630 missense possibly damaging 0.90
R2067:Gfpt1 UTSW 6 87057754 missense probably benign 0.02
R2400:Gfpt1 UTSW 6 87087348 missense probably damaging 1.00
R2438:Gfpt1 UTSW 6 87057745 missense probably null 1.00
R3104:Gfpt1 UTSW 6 87057646 missense probably benign 0.16
R3105:Gfpt1 UTSW 6 87057646 missense probably benign 0.16
R4738:Gfpt1 UTSW 6 87054747 intron probably benign
R5070:Gfpt1 UTSW 6 87053745 splice site probably null
R5292:Gfpt1 UTSW 6 87076255 critical splice acceptor site probably null
R5392:Gfpt1 UTSW 6 87077157 missense probably damaging 0.99
R5481:Gfpt1 UTSW 6 87050969 missense probably damaging 1.00
R5646:Gfpt1 UTSW 6 87042999 start codon destroyed probably null 0.92
R6003:Gfpt1 UTSW 6 87088248 unclassified probably null
R6031:Gfpt1 UTSW 6 87086320 missense probably damaging 1.00
R6031:Gfpt1 UTSW 6 87086320 missense probably damaging 1.00
R6045:Gfpt1 UTSW 6 87085257 missense probably damaging 1.00
R6341:Gfpt1 UTSW 6 87088145 missense probably damaging 1.00
R6980:Gfpt1 UTSW 6 87077089 missense probably damaging 1.00
R7120:Gfpt1 UTSW 6 87087393 missense probably benign 0.25
R7123:Gfpt1 UTSW 6 87056186 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGGATTGAGTGCTCCTC -3'
(R):5'- GATCGTATTTTGAAGCTCAGGAAC -3'

Sequencing Primer
(F):5'- TTTGAACACAAGGCCCTGTG -3'
(R):5'- TTGAAGCTCAGGAACAATTTAAACCC -3'
Posted On2016-11-09