Incidental Mutation 'R5666:Foxm1'
ID444424
Institutional Source Beutler Lab
Gene Symbol Foxm1
Ensembl Gene ENSMUSG00000001517
Gene Nameforkhead box M1
SynonymsWIN, Mpm2, Foxm1b, Trident, Fkh16, HFH-11B
MMRRC Submission 043309-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5666 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location128362967-128376146 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 128373167 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 339 (S339L)
Ref Sequence ENSEMBL: ENSMUSP00000145305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073316] [ENSMUST00000100926] [ENSMUST00000112148] [ENSMUST00000130785] [ENSMUST00000203040] [ENSMUST00000204223]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073316
AA Change: S492L

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000073041
Gene: ENSMUSG00000001517
AA Change: S492L

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 35 55 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 140 158 N/A INTRINSIC
FH 232 319 2.86e-42 SMART
low complexity region 429 454 N/A INTRINSIC
low complexity region 504 515 N/A INTRINSIC
low complexity region 533 546 N/A INTRINSIC
low complexity region 685 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100926
SMART Domains Protein: ENSMUSP00000098486
Gene: ENSMUSG00000079304

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Pfam:DUF4532 28 306 1.9e-158 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112148
AA Change: S477L

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107776
Gene: ENSMUSG00000001517
AA Change: S477L

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 35 55 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 140 158 N/A INTRINSIC
FH 232 319 2.86e-42 SMART
low complexity region 414 439 N/A INTRINSIC
low complexity region 489 500 N/A INTRINSIC
low complexity region 518 531 N/A INTRINSIC
low complexity region 670 687 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125456
Predicted Effect probably benign
Transcript: ENSMUST00000130785
SMART Domains Protein: ENSMUSP00000145112
Gene: ENSMUSG00000079304

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Pfam:DUF4532 28 223 3.9e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153423
Predicted Effect possibly damaging
Transcript: ENSMUST00000203040
AA Change: S339L

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000145305
Gene: ENSMUSG00000001517
AA Change: S339L

DomainStartEndE-ValueType
FH 78 165 1.2e-44 SMART
low complexity region 276 301 N/A INTRINSIC
low complexity region 351 362 N/A INTRINSIC
low complexity region 380 393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203779
Predicted Effect probably benign
Transcript: ENSMUST00000204223
SMART Domains Protein: ENSMUSP00000145012
Gene: ENSMUSG00000108011

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 190 201 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional activator involved in cell proliferation. The encoded protein is phosphorylated in M phase and regulates the expression of several cell cycle genes, such as cyclin B1 and cyclin D1. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a null allele die in utero exhibiting reduced hepatoblast mitosis, impaired liver, bile duct and lung development, myocardial defects and ventricular hypoplasia. Most homozygotes for another null allele die perinatally with myocardialdefects and polyploidy in heart and liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik T C 5: 99,979,209 probably benign Het
Abce1 C A 8: 79,690,277 E368D probably benign Het
Bmper T A 9: 23,473,463 M588K probably damaging Het
Bop1 T C 15: 76,454,233 E503G probably benign Het
Btla A T 16: 45,250,419 D247V probably damaging Het
Cap2 T A 13: 46,531,083 probably null Het
Chd2 A T 7: 73,441,717 I1592K probably benign Het
Chd3 T C 11: 69,353,351 E1202G possibly damaging Het
Cmya5 T C 13: 93,045,949 I3568V possibly damaging Het
Col4a4 A G 1: 82,485,579 probably null Het
Cpxm2 C T 7: 132,054,896 E546K probably benign Het
Cyp2j5 C T 4: 96,658,693 V195I probably benign Het
Ddb2 C T 2: 91,212,581 V353M probably damaging Het
Dscam G A 16: 96,718,164 T791I probably benign Het
Dtd2 T A 12: 51,999,860 L65F probably damaging Het
E2f1 T A 2: 154,569,181 probably benign Het
Ephb3 A G 16: 21,222,491 N732S probably benign Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Fzd6 A T 15: 39,031,115 R225S probably benign Het
Gfpt1 A T 6: 87,053,813 I60F possibly damaging Het
Glce A G 9: 62,060,511 S453P probably damaging Het
Gm38100 C T 1: 175,921,613 T415M probably damaging Het
Gm4787 G A 12: 81,378,031 T451I probably benign Het
Hs2st1 A T 3: 144,569,793 V22E probably damaging Het
Hspa9 T C 18: 34,954,247 I2V probably null Het
Ikzf2 A G 1: 69,577,900 V96A probably benign Het
Ilkap T C 1: 91,391,141 T38A probably benign Het
Lpin3 A G 2: 160,897,330 T353A probably benign Het
Myh1 T A 11: 67,221,352 I1744N probably benign Het
Nadsyn1 C T 7: 143,807,431 G335S probably damaging Het
Ndc1 T C 4: 107,389,526 V382A possibly damaging Het
Ndufaf4 A T 4: 24,898,636 D64V probably damaging Het
Nfe2l2 T C 2: 75,677,118 T213A probably benign Het
Nkain4 A G 2: 180,943,202 L73P probably damaging Het
Nmt1 C T 11: 103,058,215 R299* probably null Het
Olfr1271 T C 2: 90,265,964 I155M probably benign Het
Olfr1373 A C 11: 52,144,698 Y277* probably null Het
Olfr173 G A 16: 58,797,061 P262S possibly damaging Het
Olfr352 T A 2: 36,870,389 D274E probably benign Het
Padi2 G T 4: 140,949,231 R560L possibly damaging Het
Palmd T C 3: 116,924,101 N249S possibly damaging Het
Pde1c A C 6: 56,126,857 probably null Het
Pdgfra T C 5: 75,173,495 S410P probably benign Het
Phldb1 T C 9: 44,715,781 M456V probably damaging Het
Pla2g2d T A 4: 138,780,280 C82S probably damaging Het
Rgs21 A G 1: 144,536,942 V48A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Slc4a2 G T 5: 24,434,838 V506L probably damaging Het
Slc7a4 A G 16: 17,575,951 probably benign Het
Sptbn5 C G 2: 120,085,567 probably benign Het
Sstr2 T A 11: 113,624,713 W153R probably damaging Het
Steap2 C T 5: 5,673,681 V400I probably benign Het
Syne2 G A 12: 75,950,959 G2236D probably benign Het
Tas2r130 T C 6: 131,630,379 N151S possibly damaging Het
Tex52 T C 6: 128,375,555 S13P probably benign Het
Tmprss13 A G 9: 45,344,955 I456V probably damaging Het
Trim24 T C 6: 37,965,601 F946S probably benign Het
Vmn2r10 A T 5: 108,999,044 Y459* probably null Het
Vwa1 A G 4: 155,774,465 L13P probably damaging Het
Zfp648 C A 1: 154,204,217 Q41K probably benign Het
Other mutations in Foxm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Foxm1 APN 6 128370967 missense possibly damaging 0.94
IGL01312:Foxm1 APN 6 128373374 missense probably damaging 0.97
IGL01317:Foxm1 APN 6 128367353 missense probably damaging 0.98
IGL01683:Foxm1 APN 6 128373488 missense probably benign 0.01
IGL01837:Foxm1 APN 6 128366204 unclassified probably benign
IGL02039:Foxm1 APN 6 128369360 missense probably damaging 1.00
IGL02490:Foxm1 APN 6 128373351 nonsense probably null
IGL02685:Foxm1 APN 6 128373107 missense possibly damaging 0.89
IGL03335:Foxm1 APN 6 128372568 missense possibly damaging 0.92
R0374:Foxm1 UTSW 6 128372603 missense probably damaging 1.00
R0625:Foxm1 UTSW 6 128373871 missense probably damaging 1.00
R1420:Foxm1 UTSW 6 128372921 missense possibly damaging 0.94
R1471:Foxm1 UTSW 6 128373874 missense probably damaging 1.00
R2013:Foxm1 UTSW 6 128375502 unclassified probably null
R4334:Foxm1 UTSW 6 128365967 missense probably damaging 1.00
R4753:Foxm1 UTSW 6 128372556 missense probably null 0.89
R4834:Foxm1 UTSW 6 128369447 missense probably damaging 1.00
R4997:Foxm1 UTSW 6 128365768 missense probably benign 0.06
R5657:Foxm1 UTSW 6 128373388 missense possibly damaging 0.95
R5763:Foxm1 UTSW 6 128366108 missense probably benign 0.06
R5982:Foxm1 UTSW 6 128371035 missense probably damaging 1.00
R6164:Foxm1 UTSW 6 128373935 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TGAAGGAATAGCCCCGCTTC -3'
(R):5'- AAGAACAGGTCAGGCTCATC -3'

Sequencing Primer
(F):5'- CGCTTCCTGCCACAGAAC -3'
(R):5'- TCAGGCTCATCCAGACAGG -3'
Posted On2016-11-09