Incidental Mutation 'R5666:Tas2r130'
ID444426
Institutional Source Beutler Lab
Gene Symbol Tas2r130
Ensembl Gene ENSMUSG00000054497
Gene Nametaste receptor, type 2, member 130
SynonymsT2R30, mt2r42, STC 7-4, Tas2r30
MMRRC Submission 043309-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5666 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location131629823-131630912 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131630379 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 151 (N151S)
Ref Sequence ENSEMBL: ENSMUSP00000063954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067597]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067597
AA Change: N151S

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000063954
Gene: ENSMUSG00000054497
AA Change: N151S

DomainStartEndE-ValueType
Pfam:TAS2R 1 304 1.7e-110 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik T C 5: 99,979,209 probably benign Het
Abce1 C A 8: 79,690,277 E368D probably benign Het
Bmper T A 9: 23,473,463 M588K probably damaging Het
Bop1 T C 15: 76,454,233 E503G probably benign Het
Btla A T 16: 45,250,419 D247V probably damaging Het
Cap2 T A 13: 46,531,083 probably null Het
Chd2 A T 7: 73,441,717 I1592K probably benign Het
Chd3 T C 11: 69,353,351 E1202G possibly damaging Het
Cmya5 T C 13: 93,045,949 I3568V possibly damaging Het
Col4a4 A G 1: 82,485,579 probably null Het
Cpxm2 C T 7: 132,054,896 E546K probably benign Het
Cyp2j5 C T 4: 96,658,693 V195I probably benign Het
Ddb2 C T 2: 91,212,581 V353M probably damaging Het
Dscam G A 16: 96,718,164 T791I probably benign Het
Dtd2 T A 12: 51,999,860 L65F probably damaging Het
E2f1 T A 2: 154,569,181 probably benign Het
Ephb3 A G 16: 21,222,491 N732S probably benign Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Foxm1 C T 6: 128,373,167 S339L possibly damaging Het
Fzd6 A T 15: 39,031,115 R225S probably benign Het
Gfpt1 A T 6: 87,053,813 I60F possibly damaging Het
Glce A G 9: 62,060,511 S453P probably damaging Het
Gm38100 C T 1: 175,921,613 T415M probably damaging Het
Gm4787 G A 12: 81,378,031 T451I probably benign Het
Hs2st1 A T 3: 144,569,793 V22E probably damaging Het
Hspa9 T C 18: 34,954,247 I2V probably null Het
Ikzf2 A G 1: 69,577,900 V96A probably benign Het
Ilkap T C 1: 91,391,141 T38A probably benign Het
Lpin3 A G 2: 160,897,330 T353A probably benign Het
Myh1 T A 11: 67,221,352 I1744N probably benign Het
Nadsyn1 C T 7: 143,807,431 G335S probably damaging Het
Ndc1 T C 4: 107,389,526 V382A possibly damaging Het
Ndufaf4 A T 4: 24,898,636 D64V probably damaging Het
Nfe2l2 T C 2: 75,677,118 T213A probably benign Het
Nkain4 A G 2: 180,943,202 L73P probably damaging Het
Nmt1 C T 11: 103,058,215 R299* probably null Het
Olfr1271 T C 2: 90,265,964 I155M probably benign Het
Olfr1373 A C 11: 52,144,698 Y277* probably null Het
Olfr173 G A 16: 58,797,061 P262S possibly damaging Het
Olfr352 T A 2: 36,870,389 D274E probably benign Het
Padi2 G T 4: 140,949,231 R560L possibly damaging Het
Palmd T C 3: 116,924,101 N249S possibly damaging Het
Pde1c A C 6: 56,126,857 probably null Het
Pdgfra T C 5: 75,173,495 S410P probably benign Het
Phldb1 T C 9: 44,715,781 M456V probably damaging Het
Pla2g2d T A 4: 138,780,280 C82S probably damaging Het
Rgs21 A G 1: 144,536,942 V48A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Slc4a2 G T 5: 24,434,838 V506L probably damaging Het
Slc7a4 A G 16: 17,575,951 probably benign Het
Sptbn5 C G 2: 120,085,567 probably benign Het
Sstr2 T A 11: 113,624,713 W153R probably damaging Het
Steap2 C T 5: 5,673,681 V400I probably benign Het
Syne2 G A 12: 75,950,959 G2236D probably benign Het
Tex52 T C 6: 128,375,555 S13P probably benign Het
Tmprss13 A G 9: 45,344,955 I456V probably damaging Het
Trim24 T C 6: 37,965,601 F946S probably benign Het
Vmn2r10 A T 5: 108,999,044 Y459* probably null Het
Vwa1 A G 4: 155,774,465 L13P probably damaging Het
Zfp648 C A 1: 154,204,217 Q41K probably benign Het
Other mutations in Tas2r130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Tas2r130 APN 6 131630271 missense probably damaging 1.00
IGL01412:Tas2r130 APN 6 131630510 nonsense probably null
IGL01554:Tas2r130 APN 6 131630083 missense probably benign 0.44
IGL01789:Tas2r130 APN 6 131630155 missense probably damaging 1.00
R1552:Tas2r130 UTSW 6 131630167 missense probably benign 0.00
R1848:Tas2r130 UTSW 6 131630597 missense probably benign 0.00
R2020:Tas2r130 UTSW 6 131630769 missense probably damaging 1.00
R2060:Tas2r130 UTSW 6 131630817 missense probably benign 0.00
R2518:Tas2r130 UTSW 6 131630073 missense probably damaging 0.98
R3810:Tas2r130 UTSW 6 131630829 start codon destroyed probably null 1.00
R6225:Tas2r130 UTSW 6 131630584 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CACTGAGTTGTATCTGCCTGG -3'
(R):5'- ACCGTTGACTTCTTCTGGAC -3'

Sequencing Primer
(F):5'- GCCTGGTGTGTCTCCAC -3'
(R):5'- CTGGACACTTACCAACCATTTAAGTG -3'
Posted On2016-11-09