Incidental Mutation 'R5667:Btbd10'
ID444475
Institutional Source Beutler Lab
Gene Symbol Btbd10
Ensembl Gene ENSMUSG00000038187
Gene NameBTB (POZ) domain containing 10
SynonymsGmrp1, 1110056N09Rik
MMRRC Submission 043310-MU
Accession Numbers

Ncbi RefSeq: NM_133700.2; MGI:1916065

Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock #R5667 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location113315626-113369392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113332724 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 165 (K165R)
Ref Sequence ENSEMBL: ENSMUSP00000113496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047091] [ENSMUST00000117577] [ENSMUST00000119278] [ENSMUST00000135510]
Predicted Effect probably damaging
Transcript: ENSMUST00000047091
AA Change: K157R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048530
Gene: ENSMUSG00000038187
AA Change: K157R

DomainStartEndE-ValueType
low complexity region 60 75 N/A INTRINSIC
low complexity region 106 147 N/A INTRINSIC
BTB 167 272 1.58e-4 SMART
low complexity region 311 322 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117577
AA Change: K165R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113496
Gene: ENSMUSG00000038187
AA Change: K165R

DomainStartEndE-ValueType
low complexity region 68 83 N/A INTRINSIC
low complexity region 114 155 N/A INTRINSIC
BTB 175 280 1.58e-4 SMART
low complexity region 319 330 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119278
AA Change: K109R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113632
Gene: ENSMUSG00000038187
AA Change: K109R

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
low complexity region 58 99 N/A INTRINSIC
BTB 119 224 1.58e-4 SMART
low complexity region 263 274 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000135510
AA Change: K157R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114806
Gene: ENSMUSG00000038187
AA Change: K157R

DomainStartEndE-ValueType
low complexity region 60 75 N/A INTRINSIC
low complexity region 106 147 N/A INTRINSIC
SCOP:d1t1da_ 167 198 3e-6 SMART
Blast:BTB 167 200 1e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139650
Meta Mutation Damage Score 0.21 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 96% (54/56)
Allele List at MGI

All alleles(12) : Targeted(2) Gene trapped(10)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930444G20Rik T A 10: 22,066,843 T413S possibly damaging Het
4932438A13Rik A T 3: 36,917,677 T520S probably benign Het
Adamts16 A T 13: 70,836,375 Y56* probably null Het
Ak2 T A 4: 129,008,247 F238I probably damaging Het
Akap8l T C 17: 32,338,292 Y115C probably damaging Het
Alms1 A G 6: 85,696,771 D3116G probably damaging Het
Arhgap24 T G 5: 102,846,171 probably null Het
Arhgap45 A G 10: 80,025,476 E491G probably damaging Het
Atp8b1 C T 18: 64,581,923 C86Y probably damaging Het
Atxn1 T C 13: 45,557,377 K693R probably benign Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
Capn11 C T 17: 45,639,674 R293Q possibly damaging Het
Chordc1 T G 9: 18,295,332 F33V probably damaging Het
Clca4b G A 3: 144,921,863 T449I probably benign Het
Clip4 A C 17: 71,789,883 M1L probably damaging Het
Cyfip1 C T 7: 55,873,730 T90I probably benign Het
Cyp4v3 G T 8: 45,308,535 T417K possibly damaging Het
D430042O09Rik T A 7: 125,843,455 probably null Het
Exoc3l4 T C 12: 111,423,417 I142T probably damaging Het
Flnb T A 14: 7,890,843 I575N probably benign Het
Foxa1 A T 12: 57,542,295 S380T probably benign Het
Foxi2 A T 7: 135,410,939 probably null Het
Gad1-ps A T 10: 99,444,533 noncoding transcript Het
Gpa33 A G 1: 166,146,791 T66A possibly damaging Het
Gpr45 A G 1: 43,033,058 Y287C probably damaging Het
H2-Eb1 C A 17: 34,314,255 Y150* probably null Het
H2-Ke6 T C 17: 34,026,461 D233G probably null Het
Ifna6 A T 4: 88,827,669 Q85L probably damaging Het
Ivns1abp G T 1: 151,354,009 L149F probably benign Het
Kank4 A G 4: 98,765,461 probably null Het
Lama2 A T 10: 27,190,544 C1114S probably damaging Het
Lmbr1l A C 15: 98,907,608 D337E possibly damaging Het
Lrrn3 A C 12: 41,452,298 S673R possibly damaging Het
Ly75 T C 2: 60,308,311 D1404G probably damaging Het
Muc4 A G 16: 32,753,720 T1199A probably benign Het
Mycn A T 12: 12,940,044 M117K possibly damaging Het
Nalcn A G 14: 123,295,406 I1314T probably damaging Het
Nod1 T C 6: 54,933,576 T869A probably benign Het
Olfr1285 C T 2: 111,408,473 noncoding transcript Het
Olfr1388 T C 11: 49,444,313 V154A probably benign Het
Plekhg2 A T 7: 28,367,639 I356N probably damaging Het
Ptpru T A 4: 131,820,190 Y112F possibly damaging Het
Rpl36al G A 12: 69,183,123 P5L possibly damaging Het
Ryr2 A G 13: 11,759,836 W1145R probably damaging Het
Slc11a2 A G 15: 100,403,288 Y295H probably damaging Het
Slc22a6 A G 19: 8,621,784 probably null Het
Styxl1 A G 5: 135,757,123 probably null Het
Tmc6 A G 11: 117,775,615 S288P possibly damaging Het
Trpv4 A G 5: 114,634,556 L371P probably damaging Het
Usp8 A G 2: 126,742,425 D518G probably benign Het
Washc4 T C 10: 83,570,028 S463P probably damaging Het
Other mutations in Btbd10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Btbd10 APN 7 113316556 missense probably damaging 1.00
IGL03223:Btbd10 APN 7 113332670 missense probably damaging 1.00
I1329:Btbd10 UTSW 7 113332875 missense probably benign 0.00
R0022:Btbd10 UTSW 7 113325781 nonsense probably null
R0022:Btbd10 UTSW 7 113325781 nonsense probably null
R0136:Btbd10 UTSW 7 113329878 missense possibly damaging 0.54
R0299:Btbd10 UTSW 7 113329878 missense possibly damaging 0.54
R0599:Btbd10 UTSW 7 113335309 splice site probably benign
R0657:Btbd10 UTSW 7 113329878 missense possibly damaging 0.54
R1401:Btbd10 UTSW 7 113347059 missense probably benign 0.06
R2916:Btbd10 UTSW 7 113332824 missense probably benign
R3429:Btbd10 UTSW 7 113351809 nonsense probably null
R3430:Btbd10 UTSW 7 113351809 nonsense probably null
R4578:Btbd10 UTSW 7 113322752 missense possibly damaging 0.93
R4626:Btbd10 UTSW 7 113328398 missense probably damaging 0.96
R5067:Btbd10 UTSW 7 113325836 missense probably damaging 0.99
R5480:Btbd10 UTSW 7 113316707 missense probably damaging 1.00
R6468:Btbd10 UTSW 7 113347059 missense probably benign 0.06
R6877:Btbd10 UTSW 7 113322760 missense probably damaging 1.00
R6952:Btbd10 UTSW 7 113351943 splice site probably null
R7059:Btbd10 UTSW 7 113329922 missense probably damaging 0.97
X0027:Btbd10 UTSW 7 113316698 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTACTGCAAAAGATCATTCAAA -3'
(R):5'- TCAGACATTTTAGAAGATTCAGTTCTC -3'

Sequencing Primer
(F):5'- ACCAAATTTAATGTTGGCTCTACCC -3'
(R):5'- CTGGAACTTGCTCTGTAGACCAG -3'
Posted On2016-11-09