Incidental Mutation 'R5667:4930444G20Rik'
ID444480
Institutional Source Beutler Lab
Gene Symbol 4930444G20Rik
Ensembl Gene ENSMUSG00000069712
Gene NameRIKEN cDNA 4930444G20 gene
Synonyms
MMRRC Submission 043310-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R5667 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location22066307-22068079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22066843 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 413 (T413S)
Ref Sequence ENSEMBL: ENSMUSP00000097613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092672]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092672
AA Change: T413S

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097613
Gene: ENSMUSG00000069712
AA Change: T413S

DomainStartEndE-ValueType
low complexity region 194 205 N/A INTRINSIC
Pfam:Peptidase_C48 315 494 1.9e-45 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4932438A13Rik A T 3: 36,917,677 T520S probably benign Het
Adamts16 A T 13: 70,836,375 Y56* probably null Het
Ak2 T A 4: 129,008,247 F238I probably damaging Het
Akap8l T C 17: 32,338,292 Y115C probably damaging Het
Alms1 A G 6: 85,696,771 D3116G probably damaging Het
Arhgap24 T G 5: 102,846,171 probably null Het
Arhgap45 A G 10: 80,025,476 E491G probably damaging Het
Atp8b1 C T 18: 64,581,923 C86Y probably damaging Het
Atxn1 T C 13: 45,557,377 K693R probably benign Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
Btbd10 T C 7: 113,332,724 K165R probably damaging Het
Capn11 C T 17: 45,639,674 R293Q possibly damaging Het
Chordc1 T G 9: 18,295,332 F33V probably damaging Het
Clca4b G A 3: 144,921,863 T449I probably benign Het
Clip4 A C 17: 71,789,883 M1L probably damaging Het
Cyfip1 C T 7: 55,873,730 T90I probably benign Het
Cyp4v3 G T 8: 45,308,535 T417K possibly damaging Het
D430042O09Rik T A 7: 125,843,455 probably null Het
Exoc3l4 T C 12: 111,423,417 I142T probably damaging Het
Flnb T A 14: 7,890,843 I575N probably benign Het
Foxa1 A T 12: 57,542,295 S380T probably benign Het
Foxi2 A T 7: 135,410,939 probably null Het
Gad1-ps A T 10: 99,444,533 noncoding transcript Het
Gpa33 A G 1: 166,146,791 T66A possibly damaging Het
Gpr45 A G 1: 43,033,058 Y287C probably damaging Het
H2-Eb1 C A 17: 34,314,255 Y150* probably null Het
H2-Ke6 T C 17: 34,026,461 D233G probably null Het
Ifna6 A T 4: 88,827,669 Q85L probably damaging Het
Ivns1abp G T 1: 151,354,009 L149F probably benign Het
Kank4 A G 4: 98,765,461 probably null Het
Lama2 A T 10: 27,190,544 C1114S probably damaging Het
Lmbr1l A C 15: 98,907,608 D337E possibly damaging Het
Lrrn3 A C 12: 41,452,298 S673R possibly damaging Het
Ly75 T C 2: 60,308,311 D1404G probably damaging Het
Muc4 A G 16: 32,753,720 T1199A probably benign Het
Mycn A T 12: 12,940,044 M117K possibly damaging Het
Nalcn A G 14: 123,295,406 I1314T probably damaging Het
Nod1 T C 6: 54,933,576 T869A probably benign Het
Olfr1285 C T 2: 111,408,473 noncoding transcript Het
Olfr1388 T C 11: 49,444,313 V154A probably benign Het
Plekhg2 A T 7: 28,367,639 I356N probably damaging Het
Ptpru T A 4: 131,820,190 Y112F possibly damaging Het
Rpl36al G A 12: 69,183,123 P5L possibly damaging Het
Ryr2 A G 13: 11,759,836 W1145R probably damaging Het
Slc11a2 A G 15: 100,403,288 Y295H probably damaging Het
Slc22a6 A G 19: 8,621,784 probably null Het
Styxl1 A G 5: 135,757,123 probably null Het
Tmc6 A G 11: 117,775,615 S288P possibly damaging Het
Trpv4 A G 5: 114,634,556 L371P probably damaging Het
Usp8 A G 2: 126,742,425 D518G probably benign Het
Washc4 T C 10: 83,570,028 S463P probably damaging Het
Other mutations in 4930444G20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02001:4930444G20Rik APN 10 22067277 missense probably benign 0.01
IGL02546:4930444G20Rik APN 10 22066927 missense probably damaging 1.00
IGL02885:4930444G20Rik APN 10 22067158 missense possibly damaging 0.94
R0543:4930444G20Rik UTSW 10 22066924 missense possibly damaging 0.88
R1762:4930444G20Rik UTSW 10 22067512 missense probably benign 0.02
R2249:4930444G20Rik UTSW 10 22067116 missense possibly damaging 0.77
R2354:4930444G20Rik UTSW 10 22067256 missense probably benign 0.19
R2870:4930444G20Rik UTSW 10 22067379 missense probably benign
R2870:4930444G20Rik UTSW 10 22067379 missense probably benign
R3777:4930444G20Rik UTSW 10 22066962 missense probably damaging 1.00
R4117:4930444G20Rik UTSW 10 22067716 missense probably benign
R4644:4930444G20Rik UTSW 10 22066761 missense probably benign 0.02
R5002:4930444G20Rik UTSW 10 22067817 missense probably damaging 0.99
R5671:4930444G20Rik UTSW 10 22066843 missense possibly damaging 0.91
R6694:4930444G20Rik UTSW 10 22067721 missense probably damaging 0.99
R6810:4930444G20Rik UTSW 10 22066717 missense probably damaging 1.00
R6923:4930444G20Rik UTSW 10 22067755 missense probably damaging 1.00
R6942:4930444G20Rik UTSW 10 22067261 missense probably benign
R7065:4930444G20Rik UTSW 10 22067298 missense probably benign 0.00
R7204:4930444G20Rik UTSW 10 22067886 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATCCTCTTCCTGAAGGTG -3'
(R):5'- AGCATGGCGGTTACAGTTCC -3'

Sequencing Primer
(F):5'- AAAAGGTCACAGGCTGGTCCC -3'
(R):5'- TACAGTTCCGTGAAAAGATGGACTC -3'
Posted On2016-11-09