Incidental Mutation 'R5667:Mycn'
ID444487
Institutional Source Beutler Lab
Gene Symbol Mycn
Ensembl Gene ENSMUSG00000037169
Gene Namev-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived
SynonymsbHLHe37, Nmyc, Nmyc-1, N-myc, Nmyc1
MMRRC Submission 043310-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5667 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location12936093-12941914 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12940044 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 117 (M117K)
Ref Sequence ENSEMBL: ENSMUSP00000114225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043396] [ENSMUST00000130990]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043396
AA Change: M117K

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000045993
Gene: ENSMUSG00000037169
AA Change: M117K

DomainStartEndE-ValueType
Pfam:Myc_N 8 370 1.4e-120 PFAM
HLH 385 437 1.09e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000130990
AA Change: M117K

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114225
Gene: ENSMUSG00000037169
AA Change: M117K

DomainStartEndE-ValueType
Pfam:Myc_N 9 370 1.1e-148 PFAM
HLH 385 437 1.09e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151534
Meta Mutation Damage Score 0.604 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MYC family and encodes a protein with a basic helix-loop-helix (bHLH) domain. This protein is located in the nucleus and must dimerize with another bHLH protein in order to bind DNA. Amplification of this gene is associated with a variety of tumors, most notably neuroblastomas. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired development of the mesonephric tubules, neuroepithelium, sensory ganglia, heart, lung, stomach, and liver. Mutants die around embryonic day 11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930444G20Rik T A 10: 22,066,843 T413S possibly damaging Het
4932438A13Rik A T 3: 36,917,677 T520S probably benign Het
Adamts16 A T 13: 70,836,375 Y56* probably null Het
Ak2 T A 4: 129,008,247 F238I probably damaging Het
Akap8l T C 17: 32,338,292 Y115C probably damaging Het
Alms1 A G 6: 85,696,771 D3116G probably damaging Het
Arhgap24 T G 5: 102,846,171 probably null Het
Arhgap45 A G 10: 80,025,476 E491G probably damaging Het
Atp8b1 C T 18: 64,581,923 C86Y probably damaging Het
Atxn1 T C 13: 45,557,377 K693R probably benign Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
Btbd10 T C 7: 113,332,724 K165R probably damaging Het
Capn11 C T 17: 45,639,674 R293Q possibly damaging Het
Chordc1 T G 9: 18,295,332 F33V probably damaging Het
Clca4b G A 3: 144,921,863 T449I probably benign Het
Clip4 A C 17: 71,789,883 M1L probably damaging Het
Cyfip1 C T 7: 55,873,730 T90I probably benign Het
Cyp4v3 G T 8: 45,308,535 T417K possibly damaging Het
D430042O09Rik T A 7: 125,843,455 probably null Het
Exoc3l4 T C 12: 111,423,417 I142T probably damaging Het
Flnb T A 14: 7,890,843 I575N probably benign Het
Foxa1 A T 12: 57,542,295 S380T probably benign Het
Foxi2 A T 7: 135,410,939 probably null Het
Gad1-ps A T 10: 99,444,533 noncoding transcript Het
Gpa33 A G 1: 166,146,791 T66A possibly damaging Het
Gpr45 A G 1: 43,033,058 Y287C probably damaging Het
H2-Eb1 C A 17: 34,314,255 Y150* probably null Het
H2-Ke6 T C 17: 34,026,461 D233G probably null Het
Ifna6 A T 4: 88,827,669 Q85L probably damaging Het
Ivns1abp G T 1: 151,354,009 L149F probably benign Het
Kank4 A G 4: 98,765,461 probably null Het
Lama2 A T 10: 27,190,544 C1114S probably damaging Het
Lmbr1l A C 15: 98,907,608 D337E possibly damaging Het
Lrrn3 A C 12: 41,452,298 S673R possibly damaging Het
Ly75 T C 2: 60,308,311 D1404G probably damaging Het
Muc4 A G 16: 32,753,720 T1199A probably benign Het
Nalcn A G 14: 123,295,406 I1314T probably damaging Het
Nod1 T C 6: 54,933,576 T869A probably benign Het
Olfr1285 C T 2: 111,408,473 noncoding transcript Het
Olfr1388 T C 11: 49,444,313 V154A probably benign Het
Plekhg2 A T 7: 28,367,639 I356N probably damaging Het
Ptpru T A 4: 131,820,190 Y112F possibly damaging Het
Rpl36al G A 12: 69,183,123 P5L possibly damaging Het
Ryr2 A G 13: 11,759,836 W1145R probably damaging Het
Slc11a2 A G 15: 100,403,288 Y295H probably damaging Het
Slc22a6 A G 19: 8,621,784 probably null Het
Styxl1 A G 5: 135,757,123 probably null Het
Tmc6 A G 11: 117,775,615 S288P possibly damaging Het
Trpv4 A G 5: 114,634,556 L371P probably damaging Het
Usp8 A G 2: 126,742,425 D518G probably benign Het
Washc4 T C 10: 83,570,028 S463P probably damaging Het
Other mutations in Mycn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Mycn APN 12 12937586 missense possibly damaging 0.91
IGL02012:Mycn APN 12 12937103 missense probably damaging 1.00
IGL02808:Mycn APN 12 12939892 missense probably benign
PIT4581001:Mycn UTSW 12 12940243 missense possibly damaging 0.82
R0282:Mycn UTSW 12 12937313 missense probably benign 0.02
R3910:Mycn UTSW 12 12937280 missense probably damaging 1.00
R4943:Mycn UTSW 12 12937079 missense probably damaging 1.00
R5827:Mycn UTSW 12 12939793 nonsense probably null
R6594:Mycn UTSW 12 12940050 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGAGTCGCTCAAGGTATCCTC -3'
(R):5'- AAGTTTGAGCTGCTGCCCAC -3'

Sequencing Primer
(F):5'- TCTCGCTTGTTCACCGGGAAG -3'
(R):5'- GAATTGGGCTACGGAGAT -3'
Posted On2016-11-09