Incidental Mutation 'R5667:Lrrn3'
ID444488
Institutional Source Beutler Lab
Gene Symbol Lrrn3
Ensembl Gene ENSMUSG00000036295
Gene Nameleucine rich repeat protein 3, neuronal
SynonymsNLRR-3
MMRRC Submission 043310-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R5667 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location41451668-41486431 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 41452298 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 673 (S673R)
Ref Sequence ENSEMBL: ENSMUSP00000043818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043884] [ENSMUST00000132121] [ENSMUST00000134965]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043884
AA Change: S673R

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000043818
Gene: ENSMUSG00000036295
AA Change: S673R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LRRNT 28 73 9.17e-4 SMART
LRR 115 138 2.63e0 SMART
LRR_TYP 139 162 1.5e-4 SMART
LRR 163 186 7.55e-1 SMART
LRR 187 210 1.76e1 SMART
LRR 211 234 1.62e1 SMART
LRR 235 258 5.11e0 SMART
LRR 260 282 3.18e1 SMART
LRR 333 356 4.44e0 SMART
LRRCT 368 420 3.7e-5 SMART
IGc2 435 503 5.04e-9 SMART
FN3 521 602 3.49e0 SMART
transmembrane domain 626 648 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132121
SMART Domains Protein: ENSMUSP00000118779
Gene: ENSMUSG00000056899

DomainStartEndE-ValueType
Pfam:Peptidase_S24 38 115 7.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134965
SMART Domains Protein: ENSMUSP00000116441
Gene: ENSMUSG00000056899

DomainStartEndE-ValueType
Pfam:Peptidase_S24 38 114 6.4e-11 PFAM
Meta Mutation Damage Score 0.1044 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 96% (54/56)
MGI Phenotype PHENOTYPE: Homozygous null mutant mice exhibited increased mean percent body fat and male homozygous mutant mice exhibited enhanced glucose tolerance when compared with controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930444G20Rik T A 10: 22,066,843 T413S possibly damaging Het
4932438A13Rik A T 3: 36,917,677 T520S probably benign Het
Adamts16 A T 13: 70,836,375 Y56* probably null Het
Ak2 T A 4: 129,008,247 F238I probably damaging Het
Akap8l T C 17: 32,338,292 Y115C probably damaging Het
Alms1 A G 6: 85,696,771 D3116G probably damaging Het
Arhgap24 T G 5: 102,846,171 probably null Het
Arhgap45 A G 10: 80,025,476 E491G probably damaging Het
Atp8b1 C T 18: 64,581,923 C86Y probably damaging Het
Atxn1 T C 13: 45,557,377 K693R probably benign Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
Btbd10 T C 7: 113,332,724 K165R probably damaging Het
Capn11 C T 17: 45,639,674 R293Q possibly damaging Het
Chordc1 T G 9: 18,295,332 F33V probably damaging Het
Clca4b G A 3: 144,921,863 T449I probably benign Het
Clip4 A C 17: 71,789,883 M1L probably damaging Het
Cyfip1 C T 7: 55,873,730 T90I probably benign Het
Cyp4v3 G T 8: 45,308,535 T417K possibly damaging Het
D430042O09Rik T A 7: 125,843,455 probably null Het
Exoc3l4 T C 12: 111,423,417 I142T probably damaging Het
Flnb T A 14: 7,890,843 I575N probably benign Het
Foxa1 A T 12: 57,542,295 S380T probably benign Het
Foxi2 A T 7: 135,410,939 probably null Het
Gad1-ps A T 10: 99,444,533 noncoding transcript Het
Gpa33 A G 1: 166,146,791 T66A possibly damaging Het
Gpr45 A G 1: 43,033,058 Y287C probably damaging Het
H2-Eb1 C A 17: 34,314,255 Y150* probably null Het
H2-Ke6 T C 17: 34,026,461 D233G probably null Het
Ifna6 A T 4: 88,827,669 Q85L probably damaging Het
Ivns1abp G T 1: 151,354,009 L149F probably benign Het
Kank4 A G 4: 98,765,461 probably null Het
Lama2 A T 10: 27,190,544 C1114S probably damaging Het
Lmbr1l A C 15: 98,907,608 D337E possibly damaging Het
Ly75 T C 2: 60,308,311 D1404G probably damaging Het
Muc4 A G 16: 32,753,720 T1199A probably benign Het
Mycn A T 12: 12,940,044 M117K possibly damaging Het
Nalcn A G 14: 123,295,406 I1314T probably damaging Het
Nod1 T C 6: 54,933,576 T869A probably benign Het
Olfr1285 C T 2: 111,408,473 noncoding transcript Het
Olfr1388 T C 11: 49,444,313 V154A probably benign Het
Plekhg2 A T 7: 28,367,639 I356N probably damaging Het
Ptpru T A 4: 131,820,190 Y112F possibly damaging Het
Rpl36al G A 12: 69,183,123 P5L possibly damaging Het
Ryr2 A G 13: 11,759,836 W1145R probably damaging Het
Slc11a2 A G 15: 100,403,288 Y295H probably damaging Het
Slc22a6 A G 19: 8,621,784 probably null Het
Styxl1 A G 5: 135,757,123 probably null Het
Tmc6 A G 11: 117,775,615 S288P possibly damaging Het
Trpv4 A G 5: 114,634,556 L371P probably damaging Het
Usp8 A G 2: 126,742,425 D518G probably benign Het
Washc4 T C 10: 83,570,028 S463P probably damaging Het
Other mutations in Lrrn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Lrrn3 APN 12 41452192 intron probably benign
IGL02825:Lrrn3 APN 12 41452593 missense probably damaging 1.00
IGL02927:Lrrn3 APN 12 41453344 missense probably damaging 1.00
IGL02970:Lrrn3 APN 12 41452360 missense probably benign
IGL02995:Lrrn3 APN 12 41452217 missense probably damaging 1.00
IGL02999:Lrrn3 APN 12 41452751 missense probably benign 0.01
IGL03182:Lrrn3 APN 12 41454021 missense probably damaging 1.00
IGL03280:Lrrn3 APN 12 41454147 missense probably damaging 0.97
PIT4469001:Lrrn3 UTSW 12 41453018 missense probably benign 0.03
R0167:Lrrn3 UTSW 12 41454015 missense probably damaging 1.00
R0414:Lrrn3 UTSW 12 41453940 missense probably damaging 1.00
R0787:Lrrn3 UTSW 12 41454231 missense probably damaging 1.00
R0894:Lrrn3 UTSW 12 41454034 missense probably damaging 1.00
R1433:Lrrn3 UTSW 12 41452584 missense possibly damaging 0.74
R1610:Lrrn3 UTSW 12 41452993 missense possibly damaging 0.89
R1834:Lrrn3 UTSW 12 41453518 missense probably damaging 1.00
R2068:Lrrn3 UTSW 12 41452996 missense probably damaging 1.00
R2871:Lrrn3 UTSW 12 41452723 missense probably benign 0.00
R2871:Lrrn3 UTSW 12 41452723 missense probably benign 0.00
R3771:Lrrn3 UTSW 12 41452870 missense probably damaging 1.00
R4408:Lrrn3 UTSW 12 41454042 missense probably benign 0.04
R4410:Lrrn3 UTSW 12 41452584 missense possibly damaging 0.74
R4684:Lrrn3 UTSW 12 41454244 missense possibly damaging 0.75
R4770:Lrrn3 UTSW 12 41452443 missense probably benign 0.08
R4927:Lrrn3 UTSW 12 41453125 missense probably damaging 1.00
R5037:Lrrn3 UTSW 12 41453595 missense probably damaging 1.00
R5482:Lrrn3 UTSW 12 41452387 missense probably benign 0.01
R5482:Lrrn3 UTSW 12 41452388 missense probably damaging 0.96
R6022:Lrrn3 UTSW 12 41453430 missense probably damaging 0.96
R6087:Lrrn3 UTSW 12 41453535 missense possibly damaging 0.84
R6129:Lrrn3 UTSW 12 41453788 nonsense probably null
R6309:Lrrn3 UTSW 12 41453206 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAAGTGACATTCCCCTGCC -3'
(R):5'- TTCCCACCGTCTATCAGAAAAG -3'

Sequencing Primer
(F):5'- AAGCAGTACTGCCGTTTC -3'
(R):5'- TGAATGTCACCACAAAAAGTCTGG -3'
Posted On2016-11-09