Incidental Mutation 'R5667:Foxa1'
ID444489
Institutional Source Beutler Lab
Gene Symbol Foxa1
Ensembl Gene ENSMUSG00000035451
Gene Nameforkhead box A1
SynonymsHnf3a, Hnf-3a, Tcf3a, Tcf-3a
MMRRC Submission 043310-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5667 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location57540628-57546916 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57542295 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 380 (S380T)
Ref Sequence ENSEMBL: ENSMUSP00000041118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044380]
Predicted Effect probably benign
Transcript: ENSMUST00000044380
AA Change: S380T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000041118
Gene: ENSMUSG00000035451
AA Change: S380T

DomainStartEndE-ValueType
low complexity region 32 60 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
FH 168 258 3.88e-62 SMART
low complexity region 273 286 N/A INTRINSIC
low complexity region 318 328 N/A INTRINSIC
low complexity region 347 365 N/A INTRINSIC
Pfam:HNF_C 393 457 1.3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218398
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the forkhead class of DNA-binding proteins. These hepatocyte nuclear factors are transcriptional activators for liver-specific transcripts such as albumin and transthyretin, and they also interact with chromatin. Similar family members in mice have roles in the regulation of metabolism and in the differentiation of the pancreas and liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit abnormal feeding, hypoglycemia, impaired glucagon secretion, hypotryglyceridemia, wasting, and lethality between postnatal days 2 and 14. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930444G20Rik T A 10: 22,066,843 T413S possibly damaging Het
4932438A13Rik A T 3: 36,917,677 T520S probably benign Het
Adamts16 A T 13: 70,836,375 Y56* probably null Het
Ak2 T A 4: 129,008,247 F238I probably damaging Het
Akap8l T C 17: 32,338,292 Y115C probably damaging Het
Alms1 A G 6: 85,696,771 D3116G probably damaging Het
Arhgap24 T G 5: 102,846,171 probably null Het
Arhgap45 A G 10: 80,025,476 E491G probably damaging Het
Atp8b1 C T 18: 64,581,923 C86Y probably damaging Het
Atxn1 T C 13: 45,557,377 K693R probably benign Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
Btbd10 T C 7: 113,332,724 K165R probably damaging Het
Capn11 C T 17: 45,639,674 R293Q possibly damaging Het
Chordc1 T G 9: 18,295,332 F33V probably damaging Het
Clca4b G A 3: 144,921,863 T449I probably benign Het
Clip4 A C 17: 71,789,883 M1L probably damaging Het
Cyfip1 C T 7: 55,873,730 T90I probably benign Het
Cyp4v3 G T 8: 45,308,535 T417K possibly damaging Het
D430042O09Rik T A 7: 125,843,455 probably null Het
Exoc3l4 T C 12: 111,423,417 I142T probably damaging Het
Flnb T A 14: 7,890,843 I575N probably benign Het
Foxi2 A T 7: 135,410,939 probably null Het
Gad1-ps A T 10: 99,444,533 noncoding transcript Het
Gpa33 A G 1: 166,146,791 T66A possibly damaging Het
Gpr45 A G 1: 43,033,058 Y287C probably damaging Het
H2-Eb1 C A 17: 34,314,255 Y150* probably null Het
H2-Ke6 T C 17: 34,026,461 D233G probably null Het
Ifna6 A T 4: 88,827,669 Q85L probably damaging Het
Ivns1abp G T 1: 151,354,009 L149F probably benign Het
Kank4 A G 4: 98,765,461 probably null Het
Lama2 A T 10: 27,190,544 C1114S probably damaging Het
Lmbr1l A C 15: 98,907,608 D337E possibly damaging Het
Lrrn3 A C 12: 41,452,298 S673R possibly damaging Het
Ly75 T C 2: 60,308,311 D1404G probably damaging Het
Muc4 A G 16: 32,753,720 T1199A probably benign Het
Mycn A T 12: 12,940,044 M117K possibly damaging Het
Nalcn A G 14: 123,295,406 I1314T probably damaging Het
Nod1 T C 6: 54,933,576 T869A probably benign Het
Olfr1285 C T 2: 111,408,473 noncoding transcript Het
Olfr1388 T C 11: 49,444,313 V154A probably benign Het
Plekhg2 A T 7: 28,367,639 I356N probably damaging Het
Ptpru T A 4: 131,820,190 Y112F possibly damaging Het
Rpl36al G A 12: 69,183,123 P5L possibly damaging Het
Ryr2 A G 13: 11,759,836 W1145R probably damaging Het
Slc11a2 A G 15: 100,403,288 Y295H probably damaging Het
Slc22a6 A G 19: 8,621,784 probably null Het
Styxl1 A G 5: 135,757,123 probably null Het
Tmc6 A G 11: 117,775,615 S288P possibly damaging Het
Trpv4 A G 5: 114,634,556 L371P probably damaging Het
Usp8 A G 2: 126,742,425 D518G probably benign Het
Washc4 T C 10: 83,570,028 S463P probably damaging Het
Other mutations in Foxa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00696:Foxa1 APN 12 57542657 missense probably damaging 1.00
IGL02371:Foxa1 APN 12 57542700 missense probably damaging 0.98
IGL03150:Foxa1 APN 12 57542296 missense probably benign 0.41
PIT4377001:Foxa1 UTSW 12 57542781 missense probably damaging 1.00
R1347:Foxa1 UTSW 12 57542284 missense probably damaging 0.99
R1347:Foxa1 UTSW 12 57542284 missense probably damaging 0.99
R1494:Foxa1 UTSW 12 57542198 missense probably damaging 0.99
R1598:Foxa1 UTSW 12 57542687 missense possibly damaging 0.69
R1809:Foxa1 UTSW 12 57542741 missense probably damaging 1.00
R5554:Foxa1 UTSW 12 57542291 missense probably benign 0.00
R5782:Foxa1 UTSW 12 57542516 missense probably benign 0.00
R6174:Foxa1 UTSW 12 57542900 missense probably damaging 1.00
R6750:Foxa1 UTSW 12 57542610 missense probably benign 0.32
R6781:Foxa1 UTSW 12 57543257 missense possibly damaging 0.74
R6995:Foxa1 UTSW 12 57542478 missense probably benign 0.00
R7209:Foxa1 UTSW 12 57543291 missense probably benign 0.03
X0020:Foxa1 UTSW 12 57543312 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ACACCTTGGTAGTAGGCTGG -3'
(R):5'- TTCAAGTGTGAGAAGCAGCC -3'

Sequencing Primer
(F):5'- TAGTAGGCTGGCTCCAGG -3'
(R):5'- TGCACGGAAAGGCTAGCC -3'
Posted On2016-11-09