Incidental Mutation 'R5667:Adamts16'
ID444496
Institutional Source Beutler Lab
Gene Symbol Adamts16
Ensembl Gene ENSMUSG00000049538
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 16
Synonyms
MMRRC Submission 043310-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5667 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location70727802-70841811 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 70836375 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 56 (Y56*)
Ref Sequence ENSEMBL: ENSMUSP00000122031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080145] [ENSMUST00000109694] [ENSMUST00000123552]
Predicted Effect probably null
Transcript: ENSMUST00000080145
AA Change: Y56*
SMART Domains Protein: ENSMUSP00000079041
Gene: ENSMUSG00000049538
AA Change: Y56*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 57 203 7.8e-34 PFAM
Pfam:Reprolysin_5 287 470 2.9e-13 PFAM
Pfam:Reprolysin_4 289 489 1.2e-8 PFAM
Pfam:Reprolysin 289 493 5.4e-32 PFAM
Pfam:Reprolysin_2 306 483 3.7e-10 PFAM
Pfam:Reprolysin_3 310 442 6.4e-11 PFAM
TSP1 587 639 1.43e-14 SMART
Pfam:ADAM_spacer1 744 856 1.3e-37 PFAM
TSP1 872 926 3.48e0 SMART
TSP1 928 985 4.84e-3 SMART
TSP1 987 1046 1.49e-3 SMART
TSP1 1052 1113 3.19e-2 SMART
TSP1 1127 1179 7.68e-6 SMART
Pfam:PLAC 1188 1218 2.9e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109694
AA Change: Y56*
SMART Domains Protein: ENSMUSP00000105316
Gene: ENSMUSG00000049538
AA Change: Y56*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 56 203 2.2e-32 PFAM
Pfam:Reprolysin_5 287 470 1.8e-13 PFAM
Pfam:Reprolysin_4 289 489 7.3e-9 PFAM
Pfam:Reprolysin 289 493 4.6e-33 PFAM
Pfam:Reprolysin_2 306 483 4.1e-10 PFAM
Pfam:Reprolysin_3 310 442 3.3e-10 PFAM
TSP1 587 639 1.43e-14 SMART
Pfam:ADAM_spacer1 744 856 1.3e-37 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000123552
AA Change: Y56*
SMART Domains Protein: ENSMUSP00000122031
Gene: ENSMUSG00000049538
AA Change: Y56*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 56 203 5.9e-33 PFAM
Pfam:Reprolysin_5 287 470 5.1e-14 PFAM
Pfam:Reprolysin_4 289 489 2.2e-9 PFAM
Pfam:Reprolysin 289 493 1.2e-33 PFAM
Pfam:Reprolysin_2 306 483 1.2e-10 PFAM
Pfam:Reprolysin_3 310 442 9.7e-11 PFAM
TSP1 587 639 1.43e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222495
Meta Mutation Damage Score 0.648 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is co-expressed with the Wilms tumor protein, Wt1, in the developing glomeruli of embryonic kidneys. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930444G20Rik T A 10: 22,066,843 T413S possibly damaging Het
4932438A13Rik A T 3: 36,917,677 T520S probably benign Het
Ak2 T A 4: 129,008,247 F238I probably damaging Het
Akap8l T C 17: 32,338,292 Y115C probably damaging Het
Alms1 A G 6: 85,696,771 D3116G probably damaging Het
Arhgap24 T G 5: 102,846,171 probably null Het
Arhgap45 A G 10: 80,025,476 E491G probably damaging Het
Atp8b1 C T 18: 64,581,923 C86Y probably damaging Het
Atxn1 T C 13: 45,557,377 K693R probably benign Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
Btbd10 T C 7: 113,332,724 K165R probably damaging Het
Capn11 C T 17: 45,639,674 R293Q possibly damaging Het
Chordc1 T G 9: 18,295,332 F33V probably damaging Het
Clca4b G A 3: 144,921,863 T449I probably benign Het
Clip4 A C 17: 71,789,883 M1L probably damaging Het
Cyfip1 C T 7: 55,873,730 T90I probably benign Het
Cyp4v3 G T 8: 45,308,535 T417K possibly damaging Het
D430042O09Rik T A 7: 125,843,455 probably null Het
Exoc3l4 T C 12: 111,423,417 I142T probably damaging Het
Flnb T A 14: 7,890,843 I575N probably benign Het
Foxa1 A T 12: 57,542,295 S380T probably benign Het
Foxi2 A T 7: 135,410,939 probably null Het
Gad1-ps A T 10: 99,444,533 noncoding transcript Het
Gpa33 A G 1: 166,146,791 T66A possibly damaging Het
Gpr45 A G 1: 43,033,058 Y287C probably damaging Het
H2-Eb1 C A 17: 34,314,255 Y150* probably null Het
H2-Ke6 T C 17: 34,026,461 D233G probably null Het
Ifna6 A T 4: 88,827,669 Q85L probably damaging Het
Ivns1abp G T 1: 151,354,009 L149F probably benign Het
Kank4 A G 4: 98,765,461 probably null Het
Lama2 A T 10: 27,190,544 C1114S probably damaging Het
Lmbr1l A C 15: 98,907,608 D337E possibly damaging Het
Lrrn3 A C 12: 41,452,298 S673R possibly damaging Het
Ly75 T C 2: 60,308,311 D1404G probably damaging Het
Muc4 A G 16: 32,753,720 T1199A probably benign Het
Mycn A T 12: 12,940,044 M117K possibly damaging Het
Nalcn A G 14: 123,295,406 I1314T probably damaging Het
Nod1 T C 6: 54,933,576 T869A probably benign Het
Olfr1285 C T 2: 111,408,473 noncoding transcript Het
Olfr1388 T C 11: 49,444,313 V154A probably benign Het
Plekhg2 A T 7: 28,367,639 I356N probably damaging Het
Ptpru T A 4: 131,820,190 Y112F possibly damaging Het
Rpl36al G A 12: 69,183,123 P5L possibly damaging Het
Ryr2 A G 13: 11,759,836 W1145R probably damaging Het
Slc11a2 A G 15: 100,403,288 Y295H probably damaging Het
Slc22a6 A G 19: 8,621,784 probably null Het
Styxl1 A G 5: 135,757,123 probably null Het
Tmc6 A G 11: 117,775,615 S288P possibly damaging Het
Trpv4 A G 5: 114,634,556 L371P probably damaging Het
Usp8 A G 2: 126,742,425 D518G probably benign Het
Washc4 T C 10: 83,570,028 S463P probably damaging Het
Other mutations in Adamts16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Adamts16 APN 13 70795484 missense probably benign 0.01
IGL01338:Adamts16 APN 13 70836115 missense probably damaging 1.00
IGL01663:Adamts16 APN 13 70793141 missense probably benign 0.01
IGL01804:Adamts16 APN 13 70800961 nonsense probably null
IGL01874:Adamts16 APN 13 70768704 missense possibly damaging 0.79
IGL01984:Adamts16 APN 13 70787147 missense probably damaging 1.00
IGL02305:Adamts16 APN 13 70772929 missense probably damaging 1.00
IGL02350:Adamts16 APN 13 70738585 missense probably benign 0.00
IGL02357:Adamts16 APN 13 70738585 missense probably benign 0.00
IGL02429:Adamts16 APN 13 70787170 splice site probably benign
IGL02450:Adamts16 APN 13 70836300 missense probably damaging 0.97
IGL02807:Adamts16 APN 13 70738778 critical splice donor site probably null
IGL03356:Adamts16 APN 13 70753291 missense probably benign 0.00
swap UTSW 13 70779518 critical splice donor site probably benign
switcheroo UTSW 13 70800954 missense probably benign
R0046:Adamts16 UTSW 13 70763460 missense probably benign 0.00
R0046:Adamts16 UTSW 13 70763460 missense probably benign 0.00
R0201:Adamts16 UTSW 13 70779644 missense possibly damaging 0.69
R0326:Adamts16 UTSW 13 70779611 missense possibly damaging 0.89
R0336:Adamts16 UTSW 13 70791794 critical splice donor site probably benign
R0369:Adamts16 UTSW 13 70779552 missense possibly damaging 0.94
R0422:Adamts16 UTSW 13 70738955 missense probably damaging 1.00
R0507:Adamts16 UTSW 13 70768647 missense probably benign
R0524:Adamts16 UTSW 13 70800894 missense probably benign 0.00
R0590:Adamts16 UTSW 13 70800954 missense probably benign
R0734:Adamts16 UTSW 13 70738481 splice site probably benign
R0787:Adamts16 UTSW 13 70738829 missense probably damaging 1.00
R0826:Adamts16 UTSW 13 70768692 missense possibly damaging 0.64
R0920:Adamts16 UTSW 13 70763561 splice site probably benign
R1027:Adamts16 UTSW 13 70767802 missense probably damaging 1.00
R1462:Adamts16 UTSW 13 70836134 missense probably benign 0.00
R1462:Adamts16 UTSW 13 70836134 missense probably benign 0.00
R1535:Adamts16 UTSW 13 70791794 critical splice donor site probably null
R1617:Adamts16 UTSW 13 70798035 missense probably benign 0.09
R1700:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1734:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1736:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1737:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1738:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1746:Adamts16 UTSW 13 70779598 synonymous probably null
R1869:Adamts16 UTSW 13 70735747 missense probably damaging 1.00
R1944:Adamts16 UTSW 13 70791886 missense possibly damaging 0.93
R1997:Adamts16 UTSW 13 70753267 missense probably benign 0.39
R2018:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R2135:Adamts16 UTSW 13 70801007 missense probably damaging 1.00
R2219:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R2228:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R3410:Adamts16 UTSW 13 70753226 missense probably benign 0.00
R3411:Adamts16 UTSW 13 70753226 missense probably benign 0.00
R3842:Adamts16 UTSW 13 70738891 missense possibly damaging 0.92
R4117:Adamts16 UTSW 13 70767992 missense probably benign 0.01
R4435:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4436:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4526:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4552:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4555:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4556:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4557:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4579:Adamts16 UTSW 13 70779624 missense probably damaging 1.00
R4639:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4640:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4641:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4642:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4672:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R5350:Adamts16 UTSW 13 70753196 nonsense probably null
R5464:Adamts16 UTSW 13 70761749 missense probably benign 0.01
R5613:Adamts16 UTSW 13 70730134 missense probably benign 0.01
R5735:Adamts16 UTSW 13 70836218 missense possibly damaging 0.94
R5762:Adamts16 UTSW 13 70738498 missense probably damaging 1.00
R5907:Adamts16 UTSW 13 70728910 missense probably damaging 1.00
R6169:Adamts16 UTSW 13 70770274 nonsense probably null
R6351:Adamts16 UTSW 13 70836203 missense probably damaging 1.00
R6665:Adamts16 UTSW 13 70779570 missense probably damaging 1.00
R6913:Adamts16 UTSW 13 70728898 missense possibly damaging 0.94
R6982:Adamts16 UTSW 13 70768520 intron probably null
R6996:Adamts16 UTSW 13 70798038 critical splice acceptor site probably null
R7313:Adamts16 UTSW 13 70772955 nonsense probably null
R7356:Adamts16 UTSW 13 70836280 missense probably benign 0.03
R7509:Adamts16 UTSW 13 70787164 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGTTGCTGGCAGCTTTG -3'
(R):5'- GCAAACTTCAGATAAATCTCCACTG -3'

Sequencing Primer
(F):5'- CTGGCAGCTTTGAGGTCGAG -3'
(R):5'- AGATCCTTCTCAGAACCC -3'
Posted On2016-11-09