Incidental Mutation 'R5737:Tdrd5'
ID444567
Institutional Source Beutler Lab
Gene Symbol Tdrd5
Ensembl Gene ENSMUSG00000060985
Gene Nametudor domain containing 5
Synonyms
MMRRC Submission 043195-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R5737 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location156255296-156303664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 156300724 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 136 (M136T)
Ref Sequence ENSEMBL: ENSMUSP00000137156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121146] [ENSMUST00000141760] [ENSMUST00000167528]
Predicted Effect probably benign
Transcript: ENSMUST00000121146
AA Change: M231T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137298
Gene: ENSMUSG00000060985
AA Change: M231T

DomainStartEndE-ValueType
Pfam:OST-HTH 6 76 3.7e-11 PFAM
Pfam:OST-HTH 126 194 1.5e-10 PFAM
Pfam:OST-HTH 290 361 7.4e-10 PFAM
TUDOR 532 590 3.25e-7 SMART
low complexity region 739 753 N/A INTRINSIC
low complexity region 1001 1021 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141760
AA Change: M136T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000137156
Gene: ENSMUSG00000060985
AA Change: M136T

DomainStartEndE-ValueType
Pfam:OST-HTH 6 75 2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167528
AA Change: M154T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137182
Gene: ENSMUSG00000060985
AA Change: M154T

DomainStartEndE-ValueType
Pfam:OST-HTH 6 75 1.4e-9 PFAM
Pfam:OST-HTH 213 284 6.4e-9 PFAM
TUDOR 455 513 3.25e-7 SMART
low complexity region 662 676 N/A INTRINSIC
low complexity region 924 944 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195064
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with defective spermatid elongation, occasional arrested male meiosis, and apoptosis of male germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A G 13: 54,559,242 V78A probably damaging Het
5830473C10Rik G T 5: 90,572,783 C271F probably damaging Het
Aldh1l2 T A 10: 83,520,325 D67V probably damaging Het
Ankfy1 T A 11: 72,732,274 D253E probably damaging Het
Arhgap42 T C 9: 9,059,068 K159R probably damaging Het
Atrnl1 C T 19: 57,777,888 A1219V possibly damaging Het
Cacna1c C T 6: 118,741,932 V386I probably damaging Het
Cacna2d2 A G 9: 107,526,747 T1015A possibly damaging Het
Cadps2 T C 6: 23,328,805 M999V probably benign Het
Ccer1 A T 10: 97,694,684 H403L possibly damaging Het
Cubn A T 2: 13,388,891 I1433N probably damaging Het
Dcbld2 T C 16: 58,460,985 V531A probably damaging Het
Dnah11 A G 12: 118,192,390 V175A probably benign Het
Dnah3 T C 7: 120,059,198 K920R probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dscaml1 C T 9: 45,745,185 R1608C probably damaging Het
Gtf3c2 A G 5: 31,168,249 probably null Het
Heca A T 10: 17,915,714 M198K possibly damaging Het
Igkv8-24 A T 6: 70,217,138 S29T probably benign Het
Lipo2 A C 19: 33,721,696 N311K probably damaging Het
Lmo7 T G 14: 101,887,236 I266S probably damaging Het
Naip2 T A 13: 100,161,854 E558V probably benign Het
Nelfa T A 5: 33,899,113 probably null Het
Phka2 ACC AC X: 160,559,866 probably null Het
Psmg2 T C 18: 67,646,037 S92P possibly damaging Het
Rasa2 C T 9: 96,570,665 probably null Het
Slc6a3 A C 13: 73,544,804 N181T probably damaging Het
Smim4 A G 14: 31,128,719 I22T probably benign Het
Tmem178b A C 6: 40,245,641 M97L possibly damaging Het
Tnfaip8l1 A G 17: 56,171,950 D80G probably benign Het
Tomt T C 7: 101,900,317 T255A probably benign Het
Vmn2r26 G T 6: 124,039,449 V291F probably benign Het
Other mutations in Tdrd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01651:Tdrd5 APN 1 156301827 missense probably benign 0.32
IGL02441:Tdrd5 APN 1 156259943 splice site probably benign
IGL02932:Tdrd5 APN 1 156270620 missense possibly damaging 0.52
R0049:Tdrd5 UTSW 1 156301903 missense probably damaging 1.00
R0416:Tdrd5 UTSW 1 156285481 missense probably damaging 0.96
R0518:Tdrd5 UTSW 1 156262941 missense probably damaging 0.99
R1439:Tdrd5 UTSW 1 156277487 missense probably damaging 1.00
R1454:Tdrd5 UTSW 1 156259836 missense probably benign 0.41
R1497:Tdrd5 UTSW 1 156255802 missense probably benign 0.28
R1774:Tdrd5 UTSW 1 156277509 missense probably damaging 1.00
R2101:Tdrd5 UTSW 1 156301639 missense probably damaging 1.00
R2125:Tdrd5 UTSW 1 156276573 missense probably damaging 0.99
R2126:Tdrd5 UTSW 1 156276573 missense probably damaging 0.99
R2197:Tdrd5 UTSW 1 156259865 missense probably benign 0.02
R3820:Tdrd5 UTSW 1 156285483 missense probably benign 0.16
R3928:Tdrd5 UTSW 1 156300778 missense probably benign 0.06
R4258:Tdrd5 UTSW 1 156259742 missense probably benign 0.00
R4502:Tdrd5 UTSW 1 156300764 missense probably benign 0.00
R4601:Tdrd5 UTSW 1 156284374 missense probably benign 0.12
R4602:Tdrd5 UTSW 1 156284374 missense probably benign 0.12
R4610:Tdrd5 UTSW 1 156284374 missense probably benign 0.12
R4611:Tdrd5 UTSW 1 156284374 missense probably benign 0.12
R4674:Tdrd5 UTSW 1 156277435 missense probably damaging 1.00
R4722:Tdrd5 UTSW 1 156302375 missense probably benign 0.31
R4778:Tdrd5 UTSW 1 156255587 missense probably damaging 0.98
R5881:Tdrd5 UTSW 1 156294500 missense probably damaging 0.98
R5900:Tdrd5 UTSW 1 156277435 nonsense probably null
R6234:Tdrd5 UTSW 1 156293377 missense possibly damaging 0.93
R6557:Tdrd5 UTSW 1 156300721 missense probably benign 0.10
R7068:Tdrd5 UTSW 1 156284271 missense probably damaging 1.00
R7184:Tdrd5 UTSW 1 156259935 missense probably benign 0.30
R7199:Tdrd5 UTSW 1 156301723 missense probably damaging 0.98
R7432:Tdrd5 UTSW 1 156302432 missense probably damaging 1.00
R7469:Tdrd5 UTSW 1 156262905 missense probably benign 0.00
X0026:Tdrd5 UTSW 1 156285427 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGTTCTATGCCCCAGTATAGG -3'
(R):5'- ATTTCCCCTTCTAAACTGAGGG -3'

Sequencing Primer
(F):5'- TGCCAGGGCCAGAAAGC -3'
(R):5'- CTGAGGGCAGTTAGTATACAGTAGCC -3'
Posted On2016-11-21