Mutagenetix > Incidental Mutation

Incidental Mutation 'R5737:Cubn'

444569

Institutional Source

Beutler Lab

Gene Symbol

Cubn

Ensembl Gene

ENSMUSG00000026726

Gene Name

cubilin

Synonyms

D2Wsu88e, intrinsic factor-cobalamin receptor

MMRRC Submission

043195-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5737 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

13281149-13496624 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 13393702 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1433 (I1433N)

Ref Sequence

ENSEMBL: ENSMUSP00000089009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091436]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000091436
AA Change: I1433N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000089009
Gene: ENSMUSG00000026726
AA Change: I1433N

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF	132	165	2.14e-5	SMART
EGF_CA	167	208	1.95e-8	SMART
EGF	213	258	2.85e-1	SMART
EGF_CA	260	301	2.66e-10	SMART
EGF_CA	302	345	7.07e-6	SMART
EGF	349	393	1.01e-1	SMART
EGF	398	430	3.73e-5	SMART
EGF_CA	432	468	8.63e-10	SMART
CUB	474	586	4.4e-21	SMART
CUB	590	702	3.82e-39	SMART
CUB	708	816	3.66e-18	SMART
CUB	817	928	3.09e-25	SMART
CUB	932	1042	1.29e-36	SMART
CUB	1048	1161	3.46e-37	SMART
CUB	1165	1277	7.24e-40	SMART
CUB	1278	1389	8.33e-31	SMART
CUB	1391	1506	3.08e-43	SMART
CUB	1510	1619	1.9e-34	SMART
CUB	1620	1734	7.24e-40	SMART
CUB	1738	1850	6.02e-37	SMART
CUB	1852	1963	1.57e-26	SMART
CUB	1978	2091	3.46e-28	SMART
CUB	2092	2213	2.88e-34	SMART
CUB	2217	2334	4.13e-35	SMART
CUB	2336	2448	3.1e-39	SMART
CUB	2452	2565	5.37e-34	SMART
CUB	2570	2687	3e-23	SMART
CUB	2689	2801	3.1e-39	SMART
CUB	2805	2919	2.36e-21	SMART
CUB	2920	3035	6.18e-25	SMART
CUB	3037	3150	5.16e-36	SMART
CUB	3157	3274	1.68e-35	SMART
CUB	3278	3393	7.17e-12	SMART
CUB	3395	3507	2.49e-29	SMART
CUB	3511	3623	2.4e-22	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, yolk sac and allantoic vasculature defects, embryonic and visceral endoderm defects, and lack somites. Heterozygotes display incomplete penetrance of premature death. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833439L19Rik	A	G	13: 54,707,055 (GRCm39)	V78A	probably damaging	Het
Albfm1	G	T	5: 90,720,642 (GRCm39)	C271F	probably damaging	Het
Aldh1l2	T	A	10: 83,356,189 (GRCm39)	D67V	probably damaging	Het
Ankfy1	T	A	11: 72,623,100 (GRCm39)	D253E	probably damaging	Het
Arhgap42	T	C	9: 9,059,069 (GRCm39)	K159R	probably damaging	Het
Atrnl1	C	T	19: 57,766,320 (GRCm39)	A1219V	possibly damaging	Het
Cacna1c	C	T	6: 118,718,893 (GRCm39)	V386I	probably damaging	Het
Cacna2d2	A	G	9: 107,403,946 (GRCm39)	T1015A	possibly damaging	Het
Cadps2	T	C	6: 23,328,804 (GRCm39)	M999V	probably benign	Het
Ccer1	A	T	10: 97,530,546 (GRCm39)	H403L	possibly damaging	Het
Dcbld2	T	C	16: 58,281,348 (GRCm39)	V531A	probably damaging	Het
Dnah11	A	G	12: 118,156,125 (GRCm39)	V175A	probably benign	Het
Dnah3	T	C	7: 119,658,421 (GRCm39)	K920R	probably benign	Het
Dnah8	G	A	17: 30,967,542 (GRCm39)	D2585N	probably benign	Het
Dscaml1	C	T	9: 45,656,483 (GRCm39)	R1608C	probably damaging	Het
Gtf3c2	A	G	5: 31,325,593 (GRCm39)		probably null	Het
Heca	A	T	10: 17,791,462 (GRCm39)	M198K	possibly damaging	Het
Igkv8-24	A	T	6: 70,194,122 (GRCm39)	S29T	probably benign	Het
Lipo2	A	C	19: 33,699,096 (GRCm39)	N311K	probably damaging	Het
Lmo7	T	G	14: 102,124,672 (GRCm39)	I266S	probably damaging	Het
Naip2	T	A	13: 100,298,362 (GRCm39)	E558V	probably benign	Het
Nelfa	T	A	5: 34,056,457 (GRCm39)		probably null	Het
Phka2	ACC	AC	X: 159,342,862 (GRCm39)		probably null	Het
Psmg2	T	C	18: 67,779,107 (GRCm39)	S92P	possibly damaging	Het
Rasa2	C	T	9: 96,452,718 (GRCm39)		probably null	Het
Slc6a3	A	C	13: 73,692,923 (GRCm39)	N181T	probably damaging	Het
Tdrd5	A	G	1: 156,128,294 (GRCm39)	M136T	probably benign	Het
Tmem178b	A	C	6: 40,222,575 (GRCm39)	M97L	possibly damaging	Het
Tnfaip8l1	A	G	17: 56,478,950 (GRCm39)	D80G	probably benign	Het
Tomt	T	C	7: 101,549,524 (GRCm39)	T255A	probably benign	Het
Uqcc5	A	G	14: 30,850,676 (GRCm39)	I22T	probably benign	Het
Vmn2r26	G	T	6: 124,016,408 (GRCm39)	V291F	probably benign	Het

Other mutations in Cubn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Cubn	APN	2	13,496,631 (GRCm39)	unclassified	probably benign
IGL00228:Cubn	APN	2	13,461,508 (GRCm39)	missense	probably damaging	1.00
IGL00231:Cubn	APN	2	13,386,660 (GRCm39)	missense	possibly damaging	0.89
IGL00327:Cubn	APN	2	13,431,867 (GRCm39)	missense	possibly damaging	0.73
IGL00470:Cubn	APN	2	13,283,229 (GRCm39)	missense	probably benign	0.00
IGL00519:Cubn	APN	2	13,287,730 (GRCm39)	missense	probably benign	0.00
IGL00562:Cubn	APN	2	13,299,041 (GRCm39)	missense	probably benign	0.01
IGL00678:Cubn	APN	2	13,472,521 (GRCm39)	missense	possibly damaging	0.47
IGL00834:Cubn	APN	2	13,386,738 (GRCm39)	missense	probably damaging	1.00
IGL00946:Cubn	APN	2	13,461,434 (GRCm39)	missense	probably damaging	0.98
IGL00971:Cubn	APN	2	13,283,219 (GRCm39)	missense	possibly damaging	0.77
IGL01124:Cubn	APN	2	13,482,904 (GRCm39)	missense	possibly damaging	0.62
IGL01287:Cubn	APN	2	13,315,377 (GRCm39)	missense	probably damaging	1.00
IGL01410:Cubn	APN	2	13,470,719 (GRCm39)	missense	probably benign	0.31
IGL01418:Cubn	APN	2	13,288,852 (GRCm39)	missense	probably benign	0.01
IGL01450:Cubn	APN	2	13,355,673 (GRCm39)	splice site	probably benign
IGL01534:Cubn	APN	2	13,470,744 (GRCm39)	nonsense	probably null
IGL01584:Cubn	APN	2	13,313,472 (GRCm39)	splice site	probably benign
IGL01595:Cubn	APN	2	13,330,027 (GRCm39)	missense	probably benign	0.05
IGL01625:Cubn	APN	2	13,311,085 (GRCm39)	missense	possibly damaging	0.76
IGL01732:Cubn	APN	2	13,494,747 (GRCm39)	nonsense	probably null
IGL01972:Cubn	APN	2	13,450,883 (GRCm39)	missense	possibly damaging	0.90
IGL02027:Cubn	APN	2	13,292,405 (GRCm39)	missense	probably damaging	1.00
IGL02033:Cubn	APN	2	13,344,657 (GRCm39)	missense	probably damaging	0.98
IGL02124:Cubn	APN	2	13,386,648 (GRCm39)	missense	probably damaging	0.99
IGL02335:Cubn	APN	2	13,432,645 (GRCm39)	splice site	probably null
IGL02491:Cubn	APN	2	13,326,039 (GRCm39)	missense	probably damaging	1.00
IGL02686:Cubn	APN	2	13,330,037 (GRCm39)	missense	possibly damaging	0.92
IGL02707:Cubn	APN	2	13,450,843 (GRCm39)	missense	probably damaging	0.99
IGL02746:Cubn	APN	2	13,449,851 (GRCm39)	missense	probably damaging	1.00
IGL02873:Cubn	APN	2	13,299,181 (GRCm39)	missense	probably benign	0.07
IGL02897:Cubn	APN	2	13,323,123 (GRCm39)	missense	possibly damaging	0.55
IGL03078:Cubn	APN	2	13,291,905 (GRCm39)	missense	possibly damaging	0.87
IGL03245:Cubn	APN	2	13,360,500 (GRCm39)	missense	probably benign	0.09
IGL03289:Cubn	APN	2	13,431,778 (GRCm39)	missense	probably benign	0.00
IGL03335:Cubn	APN	2	13,365,140 (GRCm39)	missense	probably damaging	1.00
IGL03355:Cubn	APN	2	13,482,868 (GRCm39)	splice site	probably null
mellow	UTSW	2	13,482,889 (GRCm39)	missense	probably damaging	1.00
PIT4354001:Cubn	UTSW	2	13,473,663 (GRCm39)	nonsense	probably null
PIT4495001:Cubn	UTSW	2	13,496,561 (GRCm39)	missense	probably benign	0.00
R0145:Cubn	UTSW	2	13,311,243 (GRCm39)	missense	probably damaging	1.00
R0220:Cubn	UTSW	2	13,361,520 (GRCm39)	missense	probably damaging	1.00
R0254:Cubn	UTSW	2	13,480,846 (GRCm39)	critical splice donor site	probably null
R0254:Cubn	UTSW	2	13,445,325 (GRCm39)	missense	possibly damaging	0.84
R0254:Cubn	UTSW	2	13,429,505 (GRCm39)	missense	probably benign	0.01
R0360:Cubn	UTSW	2	13,315,318 (GRCm39)	splice site	probably benign
R0364:Cubn	UTSW	2	13,315,318 (GRCm39)	splice site	probably benign
R0383:Cubn	UTSW	2	13,435,770 (GRCm39)	missense	probably damaging	1.00
R0419:Cubn	UTSW	2	13,474,575 (GRCm39)	missense	possibly damaging	0.87
R0419:Cubn	UTSW	2	13,474,574 (GRCm39)	missense	possibly damaging	0.77
R0498:Cubn	UTSW	2	13,449,078 (GRCm39)	missense	probably damaging	0.99
R0560:Cubn	UTSW	2	13,433,491 (GRCm39)	missense	probably damaging	1.00
R0615:Cubn	UTSW	2	13,365,063 (GRCm39)	splice site	probably null
R0735:Cubn	UTSW	2	13,496,500 (GRCm39)	splice site	probably benign
R0780:Cubn	UTSW	2	13,461,424 (GRCm39)	missense	probably damaging	1.00
R0899:Cubn	UTSW	2	13,367,139 (GRCm39)	missense	possibly damaging	0.54
R1118:Cubn	UTSW	2	13,341,053 (GRCm39)	missense	possibly damaging	0.78
R1182:Cubn	UTSW	2	13,449,811 (GRCm39)	missense	probably damaging	0.98
R1439:Cubn	UTSW	2	13,292,379 (GRCm39)	missense	probably damaging	0.96
R1450:Cubn	UTSW	2	13,365,130 (GRCm39)	missense	probably damaging	1.00
R1464:Cubn	UTSW	2	13,330,099 (GRCm39)	missense	possibly damaging	0.87
R1464:Cubn	UTSW	2	13,330,099 (GRCm39)	missense	possibly damaging	0.87
R1476:Cubn	UTSW	2	13,480,931 (GRCm39)	missense	probably benign	0.04
R1508:Cubn	UTSW	2	13,431,916 (GRCm39)	missense	probably benign	0.25
R1532:Cubn	UTSW	2	13,292,472 (GRCm39)	missense	probably damaging	1.00
R1562:Cubn	UTSW	2	13,432,778 (GRCm39)	missense	probably damaging	1.00
R1598:Cubn	UTSW	2	13,474,600 (GRCm39)	missense	probably benign	0.00
R1761:Cubn	UTSW	2	13,494,128 (GRCm39)	critical splice donor site	probably null
R1862:Cubn	UTSW	2	13,313,372 (GRCm39)	missense	probably damaging	1.00
R1874:Cubn	UTSW	2	13,327,813 (GRCm39)	missense	probably damaging	1.00
R1923:Cubn	UTSW	2	13,315,337 (GRCm39)	missense	probably damaging	1.00
R1944:Cubn	UTSW	2	13,283,349 (GRCm39)	missense	probably benign	0.01
R1960:Cubn	UTSW	2	13,344,828 (GRCm39)	splice site	probably null
R2021:Cubn	UTSW	2	13,313,360 (GRCm39)	missense	probably benign	0.09
R2137:Cubn	UTSW	2	13,340,978 (GRCm39)	missense	probably benign	0.01
R2138:Cubn	UTSW	2	13,449,189 (GRCm39)	missense	probably damaging	0.99
R2139:Cubn	UTSW	2	13,340,978 (GRCm39)	missense	probably benign	0.01
R2179:Cubn	UTSW	2	13,323,053 (GRCm39)	missense	possibly damaging	0.85
R2328:Cubn	UTSW	2	13,408,891 (GRCm39)	nonsense	probably null
R2369:Cubn	UTSW	2	13,496,028 (GRCm39)	missense	probably damaging	1.00
R2428:Cubn	UTSW	2	13,480,961 (GRCm39)	missense	probably damaging	1.00
R2435:Cubn	UTSW	2	13,323,083 (GRCm39)	missense	probably damaging	1.00
R2567:Cubn	UTSW	2	13,283,167 (GRCm39)	splice site	probably null
R2850:Cubn	UTSW	2	13,327,764 (GRCm39)	missense	probably damaging	1.00
R2853:Cubn	UTSW	2	13,435,645 (GRCm39)	missense	probably benign	0.00
R2893:Cubn	UTSW	2	13,362,950 (GRCm39)	missense	possibly damaging	0.61
R3107:Cubn	UTSW	2	13,367,158 (GRCm39)	missense	possibly damaging	0.73
R3109:Cubn	UTSW	2	13,367,158 (GRCm39)	missense	possibly damaging	0.73
R3119:Cubn	UTSW	2	13,362,973 (GRCm39)	missense	possibly damaging	0.90
R3405:Cubn	UTSW	2	13,338,319 (GRCm39)	missense	probably benign	0.00
R3703:Cubn	UTSW	2	13,355,754 (GRCm39)	missense	probably damaging	1.00
R3704:Cubn	UTSW	2	13,355,754 (GRCm39)	missense	probably damaging	1.00
R3705:Cubn	UTSW	2	13,355,754 (GRCm39)	missense	probably damaging	1.00
R3764:Cubn	UTSW	2	13,336,396 (GRCm39)	missense	possibly damaging	0.79
R3792:Cubn	UTSW	2	13,432,725 (GRCm39)	missense	probably damaging	1.00
R3802:Cubn	UTSW	2	13,365,164 (GRCm39)	missense	probably benign	0.01
R3813:Cubn	UTSW	2	13,299,136 (GRCm39)	missense	probably damaging	1.00
R3845:Cubn	UTSW	2	13,287,819 (GRCm39)	missense	probably damaging	1.00
R3846:Cubn	UTSW	2	13,287,819 (GRCm39)	missense	probably damaging	1.00
R3900:Cubn	UTSW	2	13,291,791 (GRCm39)	critical splice donor site	probably null
R3921:Cubn	UTSW	2	13,331,488 (GRCm39)	missense	probably damaging	1.00
R4075:Cubn	UTSW	2	13,318,810 (GRCm39)	missense	possibly damaging	0.58
R4082:Cubn	UTSW	2	13,433,374 (GRCm39)	intron	probably benign
R4405:Cubn	UTSW	2	13,470,841 (GRCm39)	missense	probably damaging	1.00
R4615:Cubn	UTSW	2	13,433,560 (GRCm39)	missense	probably damaging	1.00
R4629:Cubn	UTSW	2	13,318,790 (GRCm39)	splice site	probably null
R4770:Cubn	UTSW	2	13,319,578 (GRCm39)	missense	possibly damaging	0.92
R4799:Cubn	UTSW	2	13,355,869 (GRCm39)	missense	probably damaging	1.00
R4799:Cubn	UTSW	2	13,291,835 (GRCm39)	missense	possibly damaging	0.94
R4812:Cubn	UTSW	2	13,463,887 (GRCm39)	missense	probably damaging	1.00
R4825:Cubn	UTSW	2	13,330,036 (GRCm39)	missense	probably damaging	1.00
R4934:Cubn	UTSW	2	13,494,721 (GRCm39)	missense	probably benign	0.06
R4967:Cubn	UTSW	2	13,352,856 (GRCm39)	missense	probably benign	0.01
R5187:Cubn	UTSW	2	13,292,379 (GRCm39)	missense	probably damaging	0.96
R5232:Cubn	UTSW	2	13,483,013 (GRCm39)	nonsense	probably null
R5305:Cubn	UTSW	2	13,393,750 (GRCm39)	missense	probably damaging	1.00
R5506:Cubn	UTSW	2	13,496,506 (GRCm39)	splice site	probably null
R5530:Cubn	UTSW	2	13,313,334 (GRCm39)	missense	probably damaging	1.00
R5531:Cubn	UTSW	2	13,355,743 (GRCm39)	missense	probably benign	0.00
R5886:Cubn	UTSW	2	13,324,834 (GRCm39)	splice site	probably benign
R5923:Cubn	UTSW	2	13,490,889 (GRCm39)	missense	possibly damaging	0.73
R6032:Cubn	UTSW	2	13,329,995 (GRCm39)	missense	probably benign	0.12
R6032:Cubn	UTSW	2	13,329,995 (GRCm39)	missense	probably benign	0.12
R6084:Cubn	UTSW	2	13,435,708 (GRCm39)	missense	probably damaging	1.00
R6087:Cubn	UTSW	2	13,432,658 (GRCm39)	missense	probably damaging	1.00
R6133:Cubn	UTSW	2	13,313,429 (GRCm39)	missense	probably benign	0.29
R6181:Cubn	UTSW	2	13,354,687 (GRCm39)	missense	probably benign	0.31
R6301:Cubn	UTSW	2	13,482,889 (GRCm39)	missense	probably damaging	1.00
R6320:Cubn	UTSW	2	13,285,006 (GRCm39)	missense	probably damaging	1.00
R6368:Cubn	UTSW	2	13,480,934 (GRCm39)	missense	probably damaging	0.98
R6368:Cubn	UTSW	2	13,435,806 (GRCm39)	missense	probably damaging	0.96
R6383:Cubn	UTSW	2	13,432,646 (GRCm39)	critical splice donor site	probably null
R6393:Cubn	UTSW	2	13,360,491 (GRCm39)	missense	probably benign	0.08
R6408:Cubn	UTSW	2	13,299,014 (GRCm39)	missense	probably damaging	1.00
R6470:Cubn	UTSW	2	13,327,804 (GRCm39)	missense	possibly damaging	0.87
R6532:Cubn	UTSW	2	13,463,813 (GRCm39)	missense	probably benign	0.01
R6599:Cubn	UTSW	2	13,315,484 (GRCm39)	missense	possibly damaging	0.95
R6629:Cubn	UTSW	2	13,435,683 (GRCm39)	missense	probably damaging	1.00
R6641:Cubn	UTSW	2	13,480,875 (GRCm39)	missense	probably damaging	1.00
R6800:Cubn	UTSW	2	13,326,066 (GRCm39)	missense	probably damaging	1.00
R6823:Cubn	UTSW	2	13,449,840 (GRCm39)	missense	probably benign	0.21
R6847:Cubn	UTSW	2	13,449,064 (GRCm39)	critical splice donor site	probably null
R6885:Cubn	UTSW	2	13,323,089 (GRCm39)	missense	probably damaging	1.00
R6962:Cubn	UTSW	2	13,352,840 (GRCm39)	missense	probably benign	0.03
R6973:Cubn	UTSW	2	13,386,648 (GRCm39)	missense	possibly damaging	0.61
R6975:Cubn	UTSW	2	13,491,600 (GRCm39)	missense	probably damaging	0.99
R7076:Cubn	UTSW	2	13,311,092 (GRCm39)	missense	probably benign	0.10
R7076:Cubn	UTSW	2	13,311,091 (GRCm39)	missense	probably benign	0.00
R7086:Cubn	UTSW	2	13,324,669 (GRCm39)	missense	probably damaging	0.98
R7162:Cubn	UTSW	2	13,347,309 (GRCm39)	missense	probably damaging	0.96
R7203:Cubn	UTSW	2	13,355,814 (GRCm39)	missense	probably benign	0.01
R7292:Cubn	UTSW	2	13,429,550 (GRCm39)	missense	probably damaging	0.99
R7307:Cubn	UTSW	2	13,345,143 (GRCm39)	missense	probably damaging	0.99
R7329:Cubn	UTSW	2	13,473,582 (GRCm39)	missense	probably damaging	0.99
R7395:Cubn	UTSW	2	13,291,875 (GRCm39)	missense	probably damaging	1.00
R7417:Cubn	UTSW	2	13,431,778 (GRCm39)	missense	probably benign	0.00
R7429:Cubn	UTSW	2	13,327,804 (GRCm39)	missense	possibly damaging	0.87
R7430:Cubn	UTSW	2	13,327,804 (GRCm39)	missense	possibly damaging	0.87
R7443:Cubn	UTSW	2	13,460,320 (GRCm39)	missense	probably damaging	1.00
R7699:Cubn	UTSW	2	13,494,728 (GRCm39)	missense	possibly damaging	0.74
R7699:Cubn	UTSW	2	13,352,989 (GRCm39)	missense	probably benign
R7700:Cubn	UTSW	2	13,494,728 (GRCm39)	missense	possibly damaging	0.74
R7700:Cubn	UTSW	2	13,352,989 (GRCm39)	missense	probably benign
R7751:Cubn	UTSW	2	13,365,176 (GRCm39)	missense	probably damaging	1.00
R7755:Cubn	UTSW	2	13,284,889 (GRCm39)	missense	probably benign	0.11
R7759:Cubn	UTSW	2	13,352,961 (GRCm39)	missense	probably damaging	1.00
R7903:Cubn	UTSW	2	13,473,680 (GRCm39)	missense	probably damaging	0.97
R7921:Cubn	UTSW	2	13,429,538 (GRCm39)	missense	probably benign	0.22
R7988:Cubn	UTSW	2	13,337,166 (GRCm39)	missense	probably benign	0.43
R8010:Cubn	UTSW	2	13,340,897 (GRCm39)	critical splice donor site	probably null
R8020:Cubn	UTSW	2	13,483,989 (GRCm39)	missense	probably benign	0.01
R8120:Cubn	UTSW	2	13,336,471 (GRCm39)	missense	probably damaging	1.00
R8133:Cubn	UTSW	2	13,393,659 (GRCm39)	missense	probably damaging	1.00
R8185:Cubn	UTSW	2	13,299,129 (GRCm39)	missense	probably benign	0.11
R8224:Cubn	UTSW	2	13,354,688 (GRCm39)	missense	probably benign	0.16
R8289:Cubn	UTSW	2	13,491,613 (GRCm39)	missense	probably benign	0.10
R8326:Cubn	UTSW	2	13,311,274 (GRCm39)	missense	probably benign	0.01
R8331:Cubn	UTSW	2	13,345,053 (GRCm39)	missense	probably damaging	1.00
R8338:Cubn	UTSW	2	13,435,658 (GRCm39)	missense	probably benign	0.08
R8341:Cubn	UTSW	2	13,433,535 (GRCm39)	missense	probably damaging	1.00
R8358:Cubn	UTSW	2	13,329,971 (GRCm39)	missense	probably benign	0.17
R8427:Cubn	UTSW	2	13,433,567 (GRCm39)	missense	probably benign	0.00
R8432:Cubn	UTSW	2	13,386,610 (GRCm39)	missense	probably benign	0.00
R8441:Cubn	UTSW	2	13,432,658 (GRCm39)	missense	probably damaging	1.00
R8442:Cubn	UTSW	2	13,318,855 (GRCm39)	missense	probably damaging	1.00
R8520:Cubn	UTSW	2	13,313,331 (GRCm39)	critical splice donor site	probably null
R8699:Cubn	UTSW	2	13,388,770 (GRCm39)	missense	probably damaging	1.00
R8753:Cubn	UTSW	2	13,313,377 (GRCm39)	nonsense	probably null
R8874:Cubn	UTSW	2	13,365,157 (GRCm39)	missense	possibly damaging	0.63
R9056:Cubn	UTSW	2	13,461,466 (GRCm39)	missense	probably damaging	1.00
R9079:Cubn	UTSW	2	13,291,914 (GRCm39)	missense	probably benign	0.02
R9143:Cubn	UTSW	2	13,337,276 (GRCm39)	splice site	probably benign
R9261:Cubn	UTSW	2	13,283,262 (GRCm39)	missense	probably damaging	1.00
R9338:Cubn	UTSW	2	13,386,703 (GRCm39)	missense	probably damaging	1.00
R9342:Cubn	UTSW	2	13,463,767 (GRCm39)	missense	probably damaging	0.99
R9603:Cubn	UTSW	2	13,292,510 (GRCm39)	missense	probably damaging	1.00
R9614:Cubn	UTSW	2	13,482,945 (GRCm39)	missense	probably benign	0.00
R9615:Cubn	UTSW	2	13,325,991 (GRCm39)	missense	possibly damaging	0.88
R9616:Cubn	UTSW	2	13,319,529 (GRCm39)	missense	probably benign	0.04
R9774:Cubn	UTSW	2	13,433,530 (GRCm39)	missense	probably benign
X0018:Cubn	UTSW	2	13,463,797 (GRCm39)	missense	probably damaging	1.00
X0022:Cubn	UTSW	2	13,480,887 (GRCm39)	missense	probably damaging	1.00
X0026:Cubn	UTSW	2	13,347,392 (GRCm39)	missense	probably damaging	1.00
X0063:Cubn	UTSW	2	13,327,773 (GRCm39)	missense	probably damaging	1.00
YA93:Cubn	UTSW	2	13,388,803 (GRCm39)	missense	probably benign	0.21
Z1088:Cubn	UTSW	2	13,299,040 (GRCm39)	missense	probably benign	0.43
Z1176:Cubn	UTSW	2	13,386,636 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AACACAATCCATTCATAGAGGAGG -3'
(R):5'- AGGAGCCATAGTTCTTTGCC -3'

Sequencing Primer
(F):5'- GGATACTTGCTAGAATGCCTAAGC -3'
(R):5'- GAATACATTCTGGCTTCTATGGTCAC -3'

Posted On

2016-11-21