Incidental Mutation 'R5738:Prtg'
ID444633
Institutional Source Beutler Lab
Gene Symbol Prtg
Ensembl Gene ENSMUSG00000036030
Gene Nameprotogenin
SynonymsIgdcc5, A230098A12Rik
MMRRC Submission 043350-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.687) question?
Stock #R5738 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location72806874-72917291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72912006 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1094 (F1094I)
Ref Sequence ENSEMBL: ENSMUSP00000055815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055535]
Predicted Effect probably benign
Transcript: ENSMUST00000055535
AA Change: F1094I

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000055815
Gene: ENSMUSG00000036030
AA Change: F1094I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc2 45 114 1.7e-8 SMART
IGc2 141 206 8.5e-12 SMART
IGc2 241 305 6.9e-12 SMART
IGc2 333 396 9.4e-10 SMART
FN3 413 496 8.9e-11 SMART
FN3 511 594 1.3e-10 SMART
FN3 613 693 1.5e-5 SMART
FN3 715 798 3e-10 SMART
FN3 814 898 4.4e-12 SMART
transmembrane domain 943 965 N/A INTRINSIC
low complexity region 966 976 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184274
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin superfamily. The encoded transmembrane protein has been associated with the development of various tissues, especially neurogenesis. It has been suggested that this gene may be associated with attention deficit hyperactivity disorder (ADHD). [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,621,917 D4826V probably damaging Het
Acoxl G A 2: 127,877,766 C149Y probably benign Het
Adamts3 G T 5: 89,708,668 H349N probably damaging Het
Ap2b1 A G 11: 83,336,430 probably null Het
Ap3m2 T C 8: 22,803,861 S58G possibly damaging Het
Bhmt2 A T 13: 93,663,290 W213R probably benign Het
Cacna1h T G 17: 25,387,049 D1092A probably damaging Het
Cbfb A C 8: 105,202,561 Q170P probably damaging Het
Ccdc73 A C 2: 104,930,986 K110N possibly damaging Het
Cep350 C A 1: 155,866,078 R2149L probably damaging Het
Cog2 A G 8: 124,546,038 T525A probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fbxl5 A G 5: 43,762,828 I251T probably benign Het
Fscn3 A G 6: 28,430,031 K67E possibly damaging Het
Glmp T A 3: 88,326,138 N133K probably benign Het
Gpr179 T C 11: 97,351,406 N204S probably damaging Het
Gtf2ird1 C T 5: 134,383,818 R613Q probably damaging Het
Hepacam A G 9: 37,383,425 D285G possibly damaging Het
Hipk4 G A 7: 27,528,416 V196M probably damaging Het
Hlx A T 1: 184,731,557 probably null Het
Igf2r A T 17: 12,717,367 D597E probably benign Het
Ighm T C 12: 113,421,495 T282A unknown Het
Igsf9b T C 9: 27,328,530 C624R probably damaging Het
Ksr2 T C 5: 117,748,799 V800A probably damaging Het
Lyn A T 4: 3,782,987 I386F probably damaging Het
Melk A G 4: 44,310,333 D102G probably damaging Het
Mettl1 G T 10: 127,041,994 E4* probably null Het
Mybl2 C T 2: 163,068,283 Q210* probably null Het
Naga C T 15: 82,334,853 W231* probably null Het
Olfr131 T C 17: 38,082,456 Y174C probably damaging Het
Olfr730 C T 14: 50,186,648 V190I probably benign Het
Olfr828 T C 9: 18,815,829 N155S possibly damaging Het
Otud4 T C 8: 79,673,461 S935P probably benign Het
P2rx7 C T 5: 122,652,789 T63I probably damaging Het
Pga5 A T 19: 10,669,660 N260K probably benign Het
Phka2 ACC AC X: 160,559,866 probably null Het
Plch1 T A 3: 63,773,655 R184W probably damaging Het
Ppm1b T C 17: 84,993,946 F85L probably benign Het
Ralgds G A 2: 28,542,526 probably benign Het
Rgs17 A C 10: 5,833,140 V149G probably damaging Het
Rnf168 A G 16: 32,282,374 E124G probably damaging Het
Sav1 T C 12: 69,976,043 E245G possibly damaging Het
Slc25a19 T C 11: 115,624,234 I33V probably benign Het
Sptbn1 T C 11: 30,145,941 I318V probably damaging Het
Tas2r136 A G 6: 132,777,744 L140P probably damaging Het
Tbc1d9 A G 8: 83,271,026 I1071V probably benign Het
Tecta G T 9: 42,373,178 N870K possibly damaging Het
Tmem230 G A 2: 132,244,128 P38L possibly damaging Het
Trpa1 G T 1: 14,875,950 H986N probably damaging Het
Wdr41 A T 13: 94,978,488 I24L possibly damaging Het
Other mutations in Prtg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Prtg APN 9 72809644 missense probably damaging 1.00
IGL00942:Prtg APN 9 72892340 missense possibly damaging 0.82
IGL01821:Prtg APN 9 72911937 missense probably damaging 0.98
IGL01901:Prtg APN 9 72855066 missense probably damaging 1.00
IGL02143:Prtg APN 9 72892324 missense probably damaging 1.00
IGL02232:Prtg APN 9 72851489 missense probably damaging 1.00
IGL02451:Prtg APN 9 72856999 missense possibly damaging 0.95
IGL02510:Prtg APN 9 72890869 missense probably damaging 0.99
IGL02739:Prtg APN 9 72851585 missense possibly damaging 0.92
IGL03136:Prtg APN 9 72856985 missense possibly damaging 0.91
FR4548:Prtg UTSW 9 72857081 critical splice donor site probably benign
FR4589:Prtg UTSW 9 72856865 missense probably damaging 1.00
FR4737:Prtg UTSW 9 72857081 critical splice donor site probably benign
R0130:Prtg UTSW 9 72809716 missense probably damaging 1.00
R0321:Prtg UTSW 9 72848025 missense possibly damaging 0.83
R0390:Prtg UTSW 9 72844958 missense probably benign 0.24
R0900:Prtg UTSW 9 72844943 missense probably benign
R1121:Prtg UTSW 9 72906167 missense probably benign 0.15
R1438:Prtg UTSW 9 72910750 splice site probably benign
R1537:Prtg UTSW 9 72809757 missense probably benign 0.00
R1590:Prtg UTSW 9 72842807 missense probably benign
R1626:Prtg UTSW 9 72844911 missense probably damaging 1.00
R1965:Prtg UTSW 9 72848322 missense probably benign 0.27
R1993:Prtg UTSW 9 72844896 missense probably benign
R2351:Prtg UTSW 9 72856824 missense probably damaging 1.00
R3737:Prtg UTSW 9 72842709 nonsense probably null
R3921:Prtg UTSW 9 72848347 missense probably damaging 0.98
R4035:Prtg UTSW 9 72842709 nonsense probably null
R4378:Prtg UTSW 9 72842760 missense possibly damaging 0.91
R4687:Prtg UTSW 9 72890798 missense probably damaging 1.00
R5469:Prtg UTSW 9 72891965 missense probably damaging 0.98
R5556:Prtg UTSW 9 72851704 missense probably damaging 1.00
R5563:Prtg UTSW 9 72856898 missense probably damaging 1.00
R5710:Prtg UTSW 9 72809640 missense probably damaging 1.00
R5868:Prtg UTSW 9 72809717 nonsense probably null
R5961:Prtg UTSW 9 72856946 missense probably benign
R5964:Prtg UTSW 9 72892254 missense probably benign 0.41
R6217:Prtg UTSW 9 72904794 missense probably damaging 1.00
R6306:Prtg UTSW 9 72906186 missense probably benign 0.42
R6395:Prtg UTSW 9 72912132 missense possibly damaging 0.80
R6455:Prtg UTSW 9 72907856 missense probably damaging 1.00
R6673:Prtg UTSW 9 72851682 missense probably damaging 0.99
R6985:Prtg UTSW 9 72851501 missense probably damaging 1.00
R7014:Prtg UTSW 9 72891985 missense possibly damaging 0.95
R7233:Prtg UTSW 9 72911991 missense probably benign 0.00
R7261:Prtg UTSW 9 72907835 missense possibly damaging 0.94
R7324:Prtg UTSW 9 72890840 missense probably damaging 0.96
R7372:Prtg UTSW 9 72851566 nonsense probably null
X0028:Prtg UTSW 9 72851716 missense possibly damaging 0.55
X0064:Prtg UTSW 9 72904892 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTTCTGGAACTTGTTCTCGAAC -3'
(R):5'- TGTCTAGACCGGAAAACCCTCG -3'

Sequencing Primer
(F):5'- CTGGAACTTGTTCTCGAACTTGAAC -3'
(R):5'- TCGGCAGCATATCGCAG -3'
Posted On2016-11-21