Incidental Mutation 'R5739:Col19a1'
ID444654
Institutional Source Beutler Lab
Gene Symbol Col19a1
Ensembl Gene ENSMUSG00000026141
Gene Namecollagen, type XIX, alpha 1
Synonyms
MMRRC Submission 043351-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5739 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location24261890-24587472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24337915 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 450 (G450S)
Ref Sequence ENSEMBL: ENSMUSP00000110899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051344] [ENSMUST00000115244]
Predicted Effect probably damaging
Transcript: ENSMUST00000051344
AA Change: G450S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052606
Gene: ENSMUSG00000026141
AA Change: G450S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 47 231 1.61e-63 SMART
low complexity region 254 266 N/A INTRINSIC
Pfam:Collagen 288 349 1e-9 PFAM
Pfam:Collagen 325 391 2.2e-10 PFAM
Pfam:Collagen 376 442 1.4e-8 PFAM
Pfam:Collagen 436 500 2.9e-9 PFAM
Pfam:Collagen 474 536 6.3e-10 PFAM
Pfam:Collagen 519 579 5.6e-10 PFAM
Pfam:Collagen 559 620 1.2e-8 PFAM
Pfam:Collagen 619 675 8.7e-11 PFAM
Pfam:Collagen 697 774 2.4e-8 PFAM
Pfam:Collagen 753 819 8.7e-10 PFAM
Pfam:Collagen 831 892 8.8e-12 PFAM
internal_repeat_2 905 943 3.52e-11 PROSPERO
internal_repeat_1 905 980 8.61e-26 PROSPERO
internal_repeat_2 947 982 3.52e-11 PROSPERO
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1030 1042 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115244
AA Change: G450S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110899
Gene: ENSMUSG00000026141
AA Change: G450S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 47 231 1.61e-63 SMART
low complexity region 254 266 N/A INTRINSIC
Pfam:Collagen 288 347 3.1e-9 PFAM
Pfam:Collagen 330 391 1.1e-9 PFAM
internal_repeat_4 455 492 1.88e-5 PROSPERO
Pfam:Collagen 519 579 2e-9 PFAM
Pfam:Collagen 559 620 4.9e-8 PFAM
Pfam:Collagen 619 675 3.5e-10 PFAM
low complexity region 723 741 N/A INTRINSIC
Pfam:Collagen 753 819 2.8e-9 PFAM
Pfam:Collagen 831 892 3.9e-11 PFAM
internal_repeat_2 905 943 1.18e-11 PROSPERO
internal_repeat_1 905 980 8.89e-27 PROSPERO
internal_repeat_2 947 982 1.18e-11 PROSPERO
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1048 1069 N/A INTRINSIC
low complexity region 1078 1115 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144297
Meta Mutation Damage Score 0.294 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XIX collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Although the function of this collagen is not known, other members of this collagen family are found in association with fibril-forming collagens such as type I and II, and serve to maintain the integrity of the extracellular matrix. The transcript produced from this gene has an unusually large 3' UTR which has not been completely sequenced. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality resulting from impaired swallowing, abnormal esophageal muscle development, and impaired muscle relaxation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A T 9: 94,520,541 V356E possibly damaging Het
4931429L15Rik A T 9: 46,309,419 S50T probably benign Het
A930011G23Rik A G 5: 99,221,430 L529P probably damaging Het
Acer2 A T 4: 86,900,555 N147Y probably damaging Het
Adamtsl1 A G 4: 86,232,664 E353G probably damaging Het
Alg6 T C 4: 99,744,500 F60L probably benign Het
Ano6 A T 15: 95,913,379 D120V probably damaging Het
Armc3 A G 2: 19,253,917 D265G possibly damaging Het
Arntl G A 7: 113,285,031 R92Q probably damaging Het
Aurkc A T 7: 7,002,860 Y249F probably benign Het
Cacna2d2 A G 9: 107,512,329 I274V probably benign Het
Camk2n2 C A 16: 20,621,080 G39C probably damaging Het
Ccdc39 A G 3: 33,826,561 L419P possibly damaging Het
Cdh23 T C 10: 60,305,609 M3117V probably damaging Het
Celsr3 A G 9: 108,827,158 E280G probably benign Het
Cherp TGCTGGTGGTGGGG TG 8: 72,467,815 probably benign Het
Clcn6 A G 4: 148,014,189 V494A probably damaging Het
Crb2 T G 2: 37,793,654 V1056G probably damaging Het
Crtac1 A G 19: 42,302,173 F363S probably damaging Het
Dnaaf2 T C 12: 69,196,941 S449G probably benign Het
Dnah7b A T 1: 46,233,992 I2427F probably damaging Het
Dnah8 T A 17: 30,719,007 D1619E probably benign Het
Dock3 A T 9: 106,973,796 S836T possibly damaging Het
Donson A T 16: 91,681,229 probably null Het
Drc3 G A 11: 60,375,130 R215H possibly damaging Het
Entpd2 T C 2: 25,399,492 S329P possibly damaging Het
Eya2 T C 2: 165,761,937 S332P probably damaging Het
Fam83f T A 15: 80,692,005 Y286N probably damaging Het
Fat4 T C 3: 38,983,134 V3645A probably benign Het
G2e3 T C 12: 51,372,504 F668L possibly damaging Het
Gm14403 T A 2: 177,509,247 C329S probably damaging Het
Hmcn1 G A 1: 150,808,697 T374I probably benign Het
Hmcn1 A T 1: 150,758,474 probably null Het
Hrnr T C 3: 93,323,129 S225P unknown Het
Ifi202b C T 1: 173,971,352 probably null Het
Il10ra A T 9: 45,256,070 D394E possibly damaging Het
Itga2b A T 11: 102,465,909 D275E probably benign Het
Jaml A T 9: 45,088,728 D108V probably damaging Het
Kir3dl1 G A X: 136,526,482 D56N probably damaging Het
Lrrtm1 T C 6: 77,244,889 V443A probably damaging Het
Mkln1 T A 6: 31,496,702 S126R probably benign Het
Myo19 T C 11: 84,897,624 I354T probably damaging Het
Nucb1 A T 7: 45,501,660 L99Q probably damaging Het
Olfr1312 A G 2: 112,042,783 F83S probably damaging Het
Pask A G 1: 93,322,056 S541P probably benign Het
Pdpr A T 8: 111,134,620 I749F possibly damaging Het
Phyhipl T C 10: 70,559,569 D269G possibly damaging Het
Pkdcc A G 17: 83,215,794 D110G probably benign Het
Ppox A G 1: 171,279,996 L115P probably damaging Het
Ppp1r12c A G 7: 4,497,282 L94P probably damaging Het
Ppp6r2 T A 15: 89,259,073 M141K probably benign Het
Prl3d1 A T 13: 27,100,012 H188L probably benign Het
Psmb3 T A 11: 97,713,470 probably benign Het
Pxdn T A 12: 29,982,334 S150T probably benign Het
Ripor3 T C 2: 167,981,283 T903A probably damaging Het
Rnase4 T C 14: 51,104,849 L10S probably benign Het
Rnf224 T C 2: 25,236,000 T114A probably benign Het
Rp1l1 A T 14: 64,032,170 E1735V probably benign Het
Rrp1b T A 17: 32,045,976 Y60N probably damaging Het
Rsbn1l A T 5: 20,905,816 V508E probably damaging Het
Rubcnl T C 14: 75,040,941 probably null Het
Rxfp4 A G 3: 88,651,902 probably benign Het
Sdccag8 A G 1: 176,826,231 T85A probably benign Het
Slc46a1 A T 11: 78,467,149 I343F possibly damaging Het
Ssh2 A G 11: 77,449,813 D597G probably damaging Het
Syne2 T A 12: 75,997,465 V3942E possibly damaging Het
Timd4 T C 11: 46,817,746 S200P probably benign Het
Tmc5 G A 7: 118,666,611 probably null Het
Tmem8 T A 17: 26,120,451 F580I probably damaging Het
Trbv16 A G 6: 41,152,079 T66A probably benign Het
Ttc3 A T 16: 94,439,324 K1103* probably null Het
Ttc7b A G 12: 100,384,233 V458A probably damaging Het
Ubxn10 A G 4: 138,720,823 S181P probably benign Het
Vmn2r11 A G 5: 109,059,248 probably null Het
Vmn2r26 A T 6: 124,025,966 N112Y probably benign Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Zc3h10 T C 10: 128,544,801 N229S probably benign Het
Zfp407 T C 18: 84,208,742 *2247W probably null Het
Zfyve1 C A 12: 83,575,136 V162L possibly damaging Het
Other mutations in Col19a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Col19a1 APN 1 24561306 missense unknown
IGL00514:Col19a1 APN 1 24536932 missense unknown
IGL00756:Col19a1 APN 1 24322942 missense possibly damaging 0.85
IGL01408:Col19a1 APN 1 24306250 splice site probably benign
IGL01608:Col19a1 APN 1 24282545 missense probably damaging 1.00
IGL01664:Col19a1 APN 1 24561335 missense unknown
IGL01906:Col19a1 APN 1 24317429 missense probably damaging 1.00
IGL01916:Col19a1 APN 1 24534241 missense unknown
IGL02040:Col19a1 APN 1 24312045 critical splice donor site probably null
IGL02407:Col19a1 APN 1 24312372 splice site probably null
IGL02505:Col19a1 APN 1 24300584 splice site probably benign
IGL02606:Col19a1 APN 1 24534116 nonsense probably null
IGL02659:Col19a1 APN 1 24534034 missense unknown
IGL02815:Col19a1 APN 1 24285251 splice site probably null
IGL02880:Col19a1 APN 1 24325973 splice site probably benign
IGL02897:Col19a1 APN 1 24534098 missense unknown
IGL03102:Col19a1 APN 1 24328053 missense probably damaging 1.00
R0038:Col19a1 UTSW 1 24559744 missense unknown
R0109:Col19a1 UTSW 1 24559768 splice site probably null
R0124:Col19a1 UTSW 1 24526458 missense unknown
R0326:Col19a1 UTSW 1 24285051 critical splice donor site probably null
R0390:Col19a1 UTSW 1 24289655 splice site probably benign
R0675:Col19a1 UTSW 1 24575455 start gained probably benign
R0826:Col19a1 UTSW 1 24526386 missense unknown
R0948:Col19a1 UTSW 1 24296801 missense probably damaging 0.98
R1014:Col19a1 UTSW 1 24301273 critical splice donor site probably null
R1619:Col19a1 UTSW 1 24534091 missense unknown
R1691:Col19a1 UTSW 1 24536941 missense unknown
R1878:Col19a1 UTSW 1 24317395 missense probably benign 0.40
R1901:Col19a1 UTSW 1 24536997 missense unknown
R1928:Col19a1 UTSW 1 24451754 splice site probably benign
R1940:Col19a1 UTSW 1 24264750 nonsense probably null
R2015:Col19a1 UTSW 1 24559753 missense unknown
R2571:Col19a1 UTSW 1 24374631 missense unknown
R2844:Col19a1 UTSW 1 24559681 missense unknown
R2845:Col19a1 UTSW 1 24559681 missense unknown
R3107:Col19a1 UTSW 1 24337936 missense possibly damaging 0.71
R3861:Col19a1 UTSW 1 24326017 missense probably damaging 1.00
R3872:Col19a1 UTSW 1 24575327 splice site probably benign
R4180:Col19a1 UTSW 1 24270392 missense probably damaging 1.00
R4195:Col19a1 UTSW 1 24534052 missense unknown
R4196:Col19a1 UTSW 1 24534052 missense unknown
R4234:Col19a1 UTSW 1 24315395 splice site probably null
R4250:Col19a1 UTSW 1 24525645 missense unknown
R4396:Col19a1 UTSW 1 24510866 missense unknown
R4405:Col19a1 UTSW 1 24534109 missense unknown
R4450:Col19a1 UTSW 1 24322035 missense probably damaging 0.96
R4583:Col19a1 UTSW 1 24561329 missense unknown
R4980:Col19a1 UTSW 1 24526483 missense unknown
R5222:Col19a1 UTSW 1 24559640 splice site probably null
R5407:Col19a1 UTSW 1 24303494 missense probably damaging 0.99
R5439:Col19a1 UTSW 1 24293112 missense probably damaging 1.00
R5740:Col19a1 UTSW 1 24337915 missense probably damaging 1.00
R5891:Col19a1 UTSW 1 24289725 missense probably damaging 1.00
R5996:Col19a1 UTSW 1 24328071 missense probably damaging 1.00
R6074:Col19a1 UTSW 1 24526483 missense unknown
R6152:Col19a1 UTSW 1 24374621 missense unknown
R6191:Col19a1 UTSW 1 24317393 missense probably damaging 1.00
R6236:Col19a1 UTSW 1 24279949 missense probably damaging 1.00
R6315:Col19a1 UTSW 1 24526452 missense unknown
R6709:Col19a1 UTSW 1 24282496 missense probably damaging 1.00
R6748:Col19a1 UTSW 1 24534070 missense unknown
R7098:Col19a1 UTSW 1 24526474 missense unknown
R7114:Col19a1 UTSW 1 24337936 missense possibly damaging 0.71
R7292:Col19a1 UTSW 1 24530008 missense unknown
R7392:Col19a1 UTSW 1 24534034 missense unknown
Z1088:Col19a1 UTSW 1 24279940 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATGTTTCTCTTGACACATCC -3'
(R):5'- AAGGAAGTCTTGGAGCTGTG -3'

Sequencing Primer
(F):5'- TCAGTAGCGCCCCCAAG -3'
(R):5'- CAGACAGGATCTTCAACATTGG -3'
Posted On2016-11-21