Incidental Mutation 'R5740:M1ap'
ID444744
Institutional Source Beutler Lab
Gene Symbol M1ap
Ensembl Gene ENSMUSG00000030041
Gene Namemeiosis 1 associated protein
SynonymsD6Mm5e
MMRRC Submission 043196-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5740 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location82946902-83030309 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82981922 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 178 (V178A)
Ref Sequence ENSEMBL: ENSMUSP00000109613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113980]
Predicted Effect probably damaging
Transcript: ENSMUST00000113980
AA Change: V178A

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109613
Gene: ENSMUSG00000030041
AA Change: V178A

DomainStartEndE-ValueType
low complexity region 151 163 N/A INTRINSIC
low complexity region 239 250 N/A INTRINSIC
low complexity region 446 457 N/A INTRINSIC
low complexity region 482 500 N/A INTRINSIC
low complexity region 504 512 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is likely to function in progression of meiosis. A similar protein in mouse plays a role in gametogenesis in both sexes. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male infertility with oligospermia, globozooaspermiam decreased testies weight and size, degeneration of seminiferous tubules, male germ cell apoptosis and arrested male meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513I03Rik G A 10: 120,778,508 probably benign Het
Arrdc5 T A 17: 56,297,838 N150Y probably benign Het
Bag1 T C 4: 40,941,526 Q269R probably null Het
C7 T C 15: 5,057,040 N40D probably benign Het
Ccdc109b A T 3: 129,918,725 M167K probably benign Het
Ccnt1 T C 15: 98,544,500 I296V probably benign Het
Col19a1 C T 1: 24,337,915 G450S probably damaging Het
F13a1 T C 13: 36,898,204 T509A probably benign Het
Fgg A T 3: 83,011,525 T282S probably benign Het
Fzd7 A G 1: 59,483,680 M241V probably benign Het
Gja1 G A 10: 56,388,189 V215M probably damaging Het
Golgb1 T C 16: 36,919,000 L2567P probably damaging Het
Grik2 T C 10: 49,113,477 N819D probably damaging Het
Grik4 C T 9: 42,808,567 R3H possibly damaging Het
Hecw2 T C 1: 53,887,603 Y1079C probably benign Het
Hivep3 A G 4: 120,096,023 E512G possibly damaging Het
Ino80 T C 2: 119,431,029 D718G probably damaging Het
Ints10 G A 8: 68,804,922 R258K probably damaging Het
Jak2 A G 19: 29,262,424 K73E possibly damaging Het
Lrba A G 3: 86,328,342 I918V probably damaging Het
Mgat4c A T 10: 102,389,321 K465N possibly damaging Het
Naip1 T A 13: 100,432,501 probably null Het
Ncbp3 T A 11: 73,053,497 N108K possibly damaging Het
Npepps A T 11: 97,236,068 D455E possibly damaging Het
Olfr1453 T C 19: 13,027,562 M256V probably benign Het
Pan2 G A 10: 128,308,164 G128S probably damaging Het
Ppp3cb A T 14: 20,501,596 I489N possibly damaging Het
Sdccag8 A G 1: 176,831,150 T134A probably benign Het
Sh3tc1 T C 5: 35,707,055 E596G probably benign Het
Shank1 T C 7: 44,353,740 S1619P possibly damaging Het
Slc46a3 A T 5: 147,879,833 C387* probably null Het
Slc5a5 G T 8: 70,888,917 probably null Het
Ttn T C 2: 76,891,374 probably benign Het
Vangl1 T C 3: 102,184,134 D212G probably damaging Het
Vmn1r52 T A 6: 90,179,194 I160N probably benign Het
Vmn2r118 C T 17: 55,593,103 M600I probably benign Het
Vmn2r7 T C 3: 64,707,233 I387V probably benign Het
Zfp369 A G 13: 65,296,767 R575G probably benign Het
Other mutations in M1ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:M1ap APN 6 82956665 missense probably damaging 1.00
IGL01511:M1ap APN 6 83028412 missense probably benign 0.00
IGL01803:M1ap APN 6 83005584 missense probably benign 0.01
IGL02243:M1ap APN 6 83026288 missense probably damaging 1.00
R1799:M1ap UTSW 6 83005510 nonsense probably null
R2073:M1ap UTSW 6 82981882 missense probably benign 0.05
R2074:M1ap UTSW 6 82981882 missense probably benign 0.05
R2355:M1ap UTSW 6 82956503 missense probably benign 0.00
R4063:M1ap UTSW 6 83003775 missense probably damaging 1.00
R5024:M1ap UTSW 6 83028358 unclassified probably benign
R5029:M1ap UTSW 6 83003832 missense probably damaging 1.00
R5564:M1ap UTSW 6 82981817 missense probably damaging 1.00
R5821:M1ap UTSW 6 82968102 missense probably benign 0.11
R5860:M1ap UTSW 6 83003814 missense probably damaging 1.00
R6190:M1ap UTSW 6 83003896 missense possibly damaging 0.60
R6773:M1ap UTSW 6 82968080 missense probably damaging 1.00
R7350:M1ap UTSW 6 82981949 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CAACAGATTGTATGTTCCTCAGTCTG -3'
(R):5'- TTATCTGTAGCAGGCACTCTTCTAAG -3'

Sequencing Primer
(F):5'- CCTCAGTCTGAATATCATGAAAAGC -3'
(R):5'- GGACCCCCTAGAACTTGAGTTATAG -3'
Posted On2016-11-21