Incidental Mutation 'R5740:Grik4'
ID444749
Institutional Source Beutler Lab
Gene Symbol Grik4
Ensembl Gene ENSMUSG00000032017
Gene Nameglutamate receptor, ionotropic, kainate 4
Synonyms6330551K01Rik, GluRgamma1, KA-1, KA1
MMRRC Submission 043196-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5740 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location42518135-42944493 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 42808567 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 3 (R3H)
Ref Sequence ENSEMBL: ENSMUSP00000110515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034515] [ENSMUST00000114865]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034515
AA Change: R3H

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034515
Gene: ENSMUSG00000032017
AA Change: R3H

DomainStartEndE-ValueType
Pfam:ANF_receptor 41 382 2.7e-60 PFAM
PBPe 417 786 1.88e-132 SMART
Lig_chan-Glu_bd 427 491 5.91e-31 SMART
transmembrane domain 805 827 N/A INTRINSIC
low complexity region 900 913 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114865
AA Change: R3H

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110515
Gene: ENSMUSG00000032017
AA Change: R3H

DomainStartEndE-ValueType
Pfam:ANF_receptor 41 382 5.1e-66 PFAM
PBPe 417 786 1.88e-132 SMART
Lig_chan-Glu_bd 427 491 5.91e-31 SMART
transmembrane domain 805 827 N/A INTRINSIC
low complexity region 900 913 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the glutamate-gated ionic channel family. Glutamate functions as the major excitatory neurotransmitter in the central nervous system through activation of ligand-gated ion channels and G protein-coupled membrane receptors. The protein encoded by this gene forms functional heteromeric kainate-preferring ionic channels with the subunits encoded by related gene family members. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced GYKI-resistant excitatory postsynaptic current. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513I03Rik G A 10: 120,778,508 probably benign Het
Arrdc5 T A 17: 56,297,838 N150Y probably benign Het
Bag1 T C 4: 40,941,526 Q269R probably null Het
C7 T C 15: 5,057,040 N40D probably benign Het
Ccdc109b A T 3: 129,918,725 M167K probably benign Het
Ccnt1 T C 15: 98,544,500 I296V probably benign Het
Col19a1 C T 1: 24,337,915 G450S probably damaging Het
F13a1 T C 13: 36,898,204 T509A probably benign Het
Fgg A T 3: 83,011,525 T282S probably benign Het
Fzd7 A G 1: 59,483,680 M241V probably benign Het
Gja1 G A 10: 56,388,189 V215M probably damaging Het
Golgb1 T C 16: 36,919,000 L2567P probably damaging Het
Grik2 T C 10: 49,113,477 N819D probably damaging Het
Hecw2 T C 1: 53,887,603 Y1079C probably benign Het
Hivep3 A G 4: 120,096,023 E512G possibly damaging Het
Ino80 T C 2: 119,431,029 D718G probably damaging Het
Ints10 G A 8: 68,804,922 R258K probably damaging Het
Jak2 A G 19: 29,262,424 K73E possibly damaging Het
Lrba A G 3: 86,328,342 I918V probably damaging Het
M1ap T C 6: 82,981,922 V178A probably damaging Het
Mgat4c A T 10: 102,389,321 K465N possibly damaging Het
Naip1 T A 13: 100,432,501 probably null Het
Ncbp3 T A 11: 73,053,497 N108K possibly damaging Het
Npepps A T 11: 97,236,068 D455E possibly damaging Het
Olfr1453 T C 19: 13,027,562 M256V probably benign Het
Pan2 G A 10: 128,308,164 G128S probably damaging Het
Ppp3cb A T 14: 20,501,596 I489N possibly damaging Het
Sdccag8 A G 1: 176,831,150 T134A probably benign Het
Sh3tc1 T C 5: 35,707,055 E596G probably benign Het
Shank1 T C 7: 44,353,740 S1619P possibly damaging Het
Slc46a3 A T 5: 147,879,833 C387* probably null Het
Slc5a5 G T 8: 70,888,917 probably null Het
Ttn T C 2: 76,891,374 probably benign Het
Vangl1 T C 3: 102,184,134 D212G probably damaging Het
Vmn1r52 T A 6: 90,179,194 I160N probably benign Het
Vmn2r118 C T 17: 55,593,103 M600I probably benign Het
Vmn2r7 T C 3: 64,707,233 I387V probably benign Het
Zfp369 A G 13: 65,296,767 R575G probably benign Het
Other mutations in Grik4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Grik4 APN 9 42521176 missense probably damaging 0.99
IGL01929:Grik4 APN 9 42566298 critical splice donor site probably null
IGL02049:Grik4 APN 9 42543753 splice site probably benign
IGL02331:Grik4 APN 9 42541988 missense probably damaging 1.00
IGL02652:Grik4 APN 9 42675277 missense possibly damaging 0.94
IGL02817:Grik4 APN 9 42622939 missense probably benign 0.00
IGL02945:Grik4 APN 9 42597879 missense possibly damaging 0.92
IGL03100:Grik4 APN 9 42550455 missense probably damaging 0.99
IGL03168:Grik4 APN 9 42671243 missense probably damaging 1.00
R0420:Grik4 UTSW 9 42622096 nonsense probably null
R0894:Grik4 UTSW 9 42688109 splice site probably benign
R1458:Grik4 UTSW 9 42521122 missense probably benign 0.21
R1502:Grik4 UTSW 9 42520873 missense probably damaging 0.97
R1502:Grik4 UTSW 9 42591447 missense probably benign 0.03
R1808:Grik4 UTSW 9 42629026 missense probably benign 0.19
R1945:Grik4 UTSW 9 42521004 missense possibly damaging 0.79
R2180:Grik4 UTSW 9 42542005 missense probably benign 0.45
R2203:Grik4 UTSW 9 42547655 missense probably damaging 1.00
R2336:Grik4 UTSW 9 42566355 missense probably damaging 1.00
R2508:Grik4 UTSW 9 42622142 missense probably damaging 1.00
R2890:Grik4 UTSW 9 42671219 missense probably damaging 1.00
R3702:Grik4 UTSW 9 42675218 missense probably damaging 0.97
R3834:Grik4 UTSW 9 42629123 missense probably benign 0.04
R4082:Grik4 UTSW 9 42597884 missense probably benign 0.00
R4604:Grik4 UTSW 9 42524586 missense probably damaging 1.00
R4711:Grik4 UTSW 9 42629093 missense probably damaging 1.00
R5417:Grik4 UTSW 9 42671248 missense probably benign 0.45
R5540:Grik4 UTSW 9 42520947 missense probably damaging 0.99
R5680:Grik4 UTSW 9 42629119 missense probably benign
R5876:Grik4 UTSW 9 42688023 missense probably damaging 1.00
R5911:Grik4 UTSW 9 42591424 missense probably damaging 1.00
R6319:Grik4 UTSW 9 42566336 missense probably damaging 1.00
R6475:Grik4 UTSW 9 42629008 missense probably benign 0.01
R6544:Grik4 UTSW 9 42547728 nonsense probably null
R7065:Grik4 UTSW 9 42543831 missense probably damaging 1.00
R7278:Grik4 UTSW 9 42622060 missense probably benign 0.25
X0028:Grik4 UTSW 9 42675227 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCACAGCCATACTCAGG -3'
(R):5'- TGCTGCCAGAACTTCTCCTG -3'

Sequencing Primer
(F):5'- ACAGCCATACTCAGGGAGGTC -3'
(R):5'- GGGGATTGTCGCCTCTCC -3'
Posted On2016-11-21