Incidental Mutation 'R5741:Ppp1r3a'
ID444783
Institutional Source Beutler Lab
Gene Symbol Ppp1r3a
Ensembl Gene ENSMUSG00000042717
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 3A
SynonymsRGL, GM
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5741 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location14713977-14755274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14719883 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 344 (V344A)
Ref Sequence ENSEMBL: ENSMUSP00000049054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045096]
Predicted Effect probably damaging
Transcript: ENSMUST00000045096
AA Change: V344A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049054
Gene: ENSMUSG00000042717
AA Change: V344A

DomainStartEndE-ValueType
low complexity region 37 51 N/A INTRINSIC
Pfam:CBM_21 124 231 2.3e-32 PFAM
low complexity region 370 381 N/A INTRINSIC
low complexity region 636 646 N/A INTRINSIC
low complexity region 952 961 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycogen-associated form of protein phosphatase-1 (PP1) derived from skeletal muscle is a heterodimer composed of a 37-kD catalytic subunit and a 124-kD targeting and regulatory subunit. This gene encodes the regulatory subunit which binds to muscle glycogen with high affinity, thereby enhancing dephosphorylation of glycogen-bound substrates for PP1 such as glycogen synthase and glycogen phosphorylase kinase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have reduced levels of skeletal muscle glycogen. Whereas one model was normoglycemic and grossly normal, another on a similar genetic background was glucose intolerant, insulin resistant, and gained weight to the point of obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik T G 11: 107,028,489 F220C probably damaging Het
4932443I19Rik A T 8: 13,734,835 Q32L possibly damaging Het
Acox3 C T 5: 35,608,324 H140Y probably benign Het
Ano3 A T 2: 110,658,273 I938K probably benign Het
Ap3m1 A C 14: 21,045,720 I14S possibly damaging Het
Arg1 T C 10: 24,917,999 T127A probably benign Het
Asah2 A G 19: 32,008,615 Y552H probably damaging Het
Chst12 A G 5: 140,523,933 N105S probably benign Het
Cped1 G A 6: 22,123,621 V458I probably benign Het
Cyld T G 8: 88,744,846 I786S probably damaging Het
Cyp2j8 C T 4: 96,444,643 V489I probably benign Het
Dlgap4 T C 2: 156,711,048 Y462H probably damaging Het
Dnah5 C A 15: 28,246,367 A617D probably benign Het
Erc2 T A 14: 28,302,869 probably null Het
Fancm A G 12: 65,101,615 N668S probably benign Het
Gm5592 A G 7: 41,289,201 I636V probably benign Het
Gtf2h2 A T 13: 100,480,558 C247S probably benign Het
Hyal5 T A 6: 24,876,495 H122Q probably damaging Het
Ints10 G A 8: 68,804,922 R258K probably damaging Het
Kir3dl1 G A X: 136,526,482 D56N probably damaging Het
Lrguk T A 6: 34,048,867 D199E probably damaging Het
Lyst A G 13: 13,634,030 D95G probably benign Het
Map2k1 A T 9: 64,214,601 L30Q possibly damaging Het
Nell1 G A 7: 50,560,890 probably null Het
Nfatc3 T A 8: 106,079,066 I181N probably damaging Het
Nipbl T C 15: 8,324,649 K1668R possibly damaging Het
Olfr1467 A G 19: 13,365,483 N285S probably damaging Het
Olfr862 A G 9: 19,883,561 V248A possibly damaging Het
Olfr924 T A 9: 38,848,603 L163* probably null Het
Otud7b C T 3: 96,144,304 T189I probably damaging Het
Pkia A T 3: 7,442,045 E62D probably benign Het
Plcb3 G A 19: 6,954,422 Q1154* probably null Het
Pole4 T C 6: 82,651,466 E105G probably damaging Het
Ptpn21 A T 12: 98,679,289 L1130Q probably damaging Het
Rapgef5 A G 12: 117,756,029 D564G probably damaging Het
Samhd1 C T 2: 157,112,831 R387H probably benign Het
Spag1 A G 15: 36,183,703 K65E possibly damaging Het
Spata31d1d A T 13: 59,728,686 V345D possibly damaging Het
Spin1 G A 13: 51,149,135 V255I possibly damaging Het
Tmem171 A G 13: 98,692,051 V197A probably benign Het
Tmigd1 T C 11: 76,907,090 V86A possibly damaging Het
Ttn T C 2: 76,712,073 D31777G probably damaging Het
Tymp T A 15: 89,376,436 M60L probably benign Het
Ugdh T C 5: 65,427,523 T19A probably damaging Het
Vmn1r234 G T 17: 21,229,469 C215F probably benign Het
Wnt5b T C 6: 119,433,729 D250G probably damaging Het
Xrn1 T A 9: 96,045,551 C1463S probably benign Het
Zfp831 T A 2: 174,645,152 I540N possibly damaging Het
Zmynd8 T C 2: 165,840,017 D189G probably damaging Het
Other mutations in Ppp1r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ppp1r3a APN 6 14755084 missense probably damaging 1.00
IGL00670:Ppp1r3a APN 6 14719060 missense probably benign 0.22
IGL00703:Ppp1r3a APN 6 14718408 missense probably benign 0.02
IGL00726:Ppp1r3a APN 6 14717852 missense probably benign 0.42
IGL00742:Ppp1r3a APN 6 14718609 missense probably benign 0.36
IGL01477:Ppp1r3a APN 6 14718346 missense probably damaging 0.99
IGL01632:Ppp1r3a APN 6 14754811 missense probably damaging 1.00
IGL02162:Ppp1r3a APN 6 14717715 missense probably damaging 1.00
IGL02374:Ppp1r3a APN 6 14718600 missense probably damaging 1.00
IGL02539:Ppp1r3a APN 6 14718459 missense probably benign 0.01
IGL02563:Ppp1r3a APN 6 14719762 missense probably benign 0.20
IGL02929:Ppp1r3a APN 6 14719811 missense probably benign 0.00
IGL03110:Ppp1r3a APN 6 14722065 splice site probably benign
IGL03290:Ppp1r3a APN 6 14754772 missense probably damaging 1.00
IGL03326:Ppp1r3a APN 6 14719766 missense probably damaging 0.96
P0041:Ppp1r3a UTSW 6 14719697 missense probably benign 0.00
PIT4445001:Ppp1r3a UTSW 6 14717777 missense probably damaging 1.00
R0015:Ppp1r3a UTSW 6 14717661 missense possibly damaging 0.58
R0077:Ppp1r3a UTSW 6 14754517 missense possibly damaging 0.64
R0368:Ppp1r3a UTSW 6 14718960 missense probably benign 0.26
R0391:Ppp1r3a UTSW 6 14719697 missense probably benign 0.43
R1793:Ppp1r3a UTSW 6 14754718 missense probably damaging 1.00
R1797:Ppp1r3a UTSW 6 14717982 missense probably benign 0.02
R1855:Ppp1r3a UTSW 6 14754994 missense probably damaging 1.00
R1864:Ppp1r3a UTSW 6 14718405 missense probably damaging 1.00
R1865:Ppp1r3a UTSW 6 14718405 missense probably damaging 1.00
R2046:Ppp1r3a UTSW 6 14722104 missense probably benign 0.12
R2122:Ppp1r3a UTSW 6 14721875 missense possibly damaging 0.95
R2437:Ppp1r3a UTSW 6 14718323 missense probably benign 0.03
R2518:Ppp1r3a UTSW 6 14719378 missense possibly damaging 0.95
R2887:Ppp1r3a UTSW 6 14718249 missense possibly damaging 0.89
R2888:Ppp1r3a UTSW 6 14718249 missense possibly damaging 0.89
R2889:Ppp1r3a UTSW 6 14718249 missense possibly damaging 0.89
R3419:Ppp1r3a UTSW 6 14719414 missense probably benign 0.01
R3886:Ppp1r3a UTSW 6 14719912 missense possibly damaging 0.87
R3937:Ppp1r3a UTSW 6 14719074 missense probably damaging 0.99
R3938:Ppp1r3a UTSW 6 14719074 missense probably damaging 0.99
R4246:Ppp1r3a UTSW 6 14719781 missense probably damaging 1.00
R4561:Ppp1r3a UTSW 6 14754682 missense probably damaging 1.00
R4701:Ppp1r3a UTSW 6 14718993 missense probably benign 0.00
R4853:Ppp1r3a UTSW 6 14719047 missense probably benign 0.03
R5076:Ppp1r3a UTSW 6 14754681 missense probably damaging 1.00
R5085:Ppp1r3a UTSW 6 14719604 missense probably damaging 1.00
R5501:Ppp1r3a UTSW 6 14719418 missense probably benign 0.02
R5725:Ppp1r3a UTSW 6 14719349 missense probably benign 0.04
R5729:Ppp1r3a UTSW 6 14719763 missense probably benign 0.06
R5841:Ppp1r3a UTSW 6 14718984 missense probably benign 0.26
R5914:Ppp1r3a UTSW 6 14718989 missense probably benign 0.09
R6091:Ppp1r3a UTSW 6 14719340 missense probably benign 0.02
R6154:Ppp1r3a UTSW 6 14754604 missense possibly damaging 0.88
R6218:Ppp1r3a UTSW 6 14718431 missense probably damaging 0.99
R6813:Ppp1r3a UTSW 6 14719571 missense probably benign 0.13
R6826:Ppp1r3a UTSW 6 14718981 nonsense probably null
R6869:Ppp1r3a UTSW 6 14754826 missense probably benign 0.39
R7109:Ppp1r3a UTSW 6 14719236 missense probably benign 0.00
R7188:Ppp1r3a UTSW 6 14719191 missense probably benign 0.00
R7262:Ppp1r3a UTSW 6 14719070 missense probably benign 0.04
R7341:Ppp1r3a UTSW 6 14718750 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACTAGTGTCTCCCAGTGATGG -3'
(R):5'- AATGAGTCAGGGGAAATCTACC -3'

Sequencing Primer
(F):5'- AATTTCTTCTGAATGTGGATGACC -3'
(R):5'- TCAGGGGAAATCTACCAGATAATTAC -3'
Posted On2016-11-21