Incidental Mutation 'R5741:Olfr924'
ID444797
Institutional Source Beutler Lab
Gene Symbol Olfr924
Ensembl Gene ENSMUSG00000062103
Gene Nameolfactory receptor 924
SynonymsMOR171-27P, GA_x6K02T2PVTD-32543982-32544908, Olfr1520-ps1, MOR171-27P, MOR171-47
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5741 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38844449-38851495 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 38848603 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 163 (L163*)
Ref Sequence ENSEMBL: ENSMUSP00000149849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072977] [ENSMUST00000217350]
Predicted Effect probably null
Transcript: ENSMUST00000072977
AA Change: L163*
SMART Domains Protein: ENSMUSP00000072744
Gene: ENSMUSG00000062103
AA Change: L163*

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 4.6e-54 PFAM
Pfam:7TM_GPCR_Srsx 32 279 7.2e-7 PFAM
Pfam:7tm_1 38 287 1.6e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000217350
AA Change: L163*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik T G 11: 107,028,489 F220C probably damaging Het
4932443I19Rik A T 8: 13,734,835 Q32L possibly damaging Het
Acox3 C T 5: 35,608,324 H140Y probably benign Het
Ano3 A T 2: 110,658,273 I938K probably benign Het
Ap3m1 A C 14: 21,045,720 I14S possibly damaging Het
Arg1 T C 10: 24,917,999 T127A probably benign Het
Asah2 A G 19: 32,008,615 Y552H probably damaging Het
Chst12 A G 5: 140,523,933 N105S probably benign Het
Cped1 G A 6: 22,123,621 V458I probably benign Het
Cyld T G 8: 88,744,846 I786S probably damaging Het
Cyp2j8 C T 4: 96,444,643 V489I probably benign Het
Dlgap4 T C 2: 156,711,048 Y462H probably damaging Het
Dnah5 C A 15: 28,246,367 A617D probably benign Het
Erc2 T A 14: 28,302,869 probably null Het
Fancm A G 12: 65,101,615 N668S probably benign Het
Gm5592 A G 7: 41,289,201 I636V probably benign Het
Gtf2h2 A T 13: 100,480,558 C247S probably benign Het
Hyal5 T A 6: 24,876,495 H122Q probably damaging Het
Ints10 G A 8: 68,804,922 R258K probably damaging Het
Kir3dl1 G A X: 136,526,482 D56N probably damaging Het
Lrguk T A 6: 34,048,867 D199E probably damaging Het
Lyst A G 13: 13,634,030 D95G probably benign Het
Map2k1 A T 9: 64,214,601 L30Q possibly damaging Het
Nell1 G A 7: 50,560,890 probably null Het
Nfatc3 T A 8: 106,079,066 I181N probably damaging Het
Nipbl T C 15: 8,324,649 K1668R possibly damaging Het
Olfr1467 A G 19: 13,365,483 N285S probably damaging Het
Olfr862 A G 9: 19,883,561 V248A possibly damaging Het
Otud7b C T 3: 96,144,304 T189I probably damaging Het
Pkia A T 3: 7,442,045 E62D probably benign Het
Plcb3 G A 19: 6,954,422 Q1154* probably null Het
Pole4 T C 6: 82,651,466 E105G probably damaging Het
Ppp1r3a A G 6: 14,719,883 V344A probably damaging Het
Ptpn21 A T 12: 98,679,289 L1130Q probably damaging Het
Rapgef5 A G 12: 117,756,029 D564G probably damaging Het
Samhd1 C T 2: 157,112,831 R387H probably benign Het
Spag1 A G 15: 36,183,703 K65E possibly damaging Het
Spata31d1d A T 13: 59,728,686 V345D possibly damaging Het
Spin1 G A 13: 51,149,135 V255I possibly damaging Het
Tmem171 A G 13: 98,692,051 V197A probably benign Het
Tmigd1 T C 11: 76,907,090 V86A possibly damaging Het
Ttn T C 2: 76,712,073 D31777G probably damaging Het
Tymp T A 15: 89,376,436 M60L probably benign Het
Ugdh T C 5: 65,427,523 T19A probably damaging Het
Vmn1r234 G T 17: 21,229,469 C215F probably benign Het
Wnt5b T C 6: 119,433,729 D250G probably damaging Het
Xrn1 T A 9: 96,045,551 C1463S probably benign Het
Zfp831 T A 2: 174,645,152 I540N possibly damaging Het
Zmynd8 T C 2: 165,840,017 D189G probably damaging Het
Other mutations in Olfr924
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Olfr924 APN 9 38848252 missense probably damaging 1.00
IGL01673:Olfr924 APN 9 38849020 missense probably benign 0.00
IGL01769:Olfr924 APN 9 38848333 missense probably benign 0.01
IGL02015:Olfr924 APN 9 38848794 missense probably damaging 0.99
IGL02525:Olfr924 APN 9 38848240 missense possibly damaging 0.82
IGL02728:Olfr924 APN 9 38848926 missense probably damaging 1.00
IGL02944:Olfr924 APN 9 38848752 missense possibly damaging 0.88
IGL03127:Olfr924 APN 9 38848209 missense probably damaging 1.00
R0613:Olfr924 UTSW 9 38848613 nonsense probably null
R0811:Olfr924 UTSW 9 38848509 missense probably benign
R0812:Olfr924 UTSW 9 38848509 missense probably benign
R1558:Olfr924 UTSW 9 38848904 missense probably benign 0.00
R1604:Olfr924 UTSW 9 38848704 missense probably benign 0.04
R1681:Olfr924 UTSW 9 38848513 missense probably damaging 1.00
R1730:Olfr924 UTSW 9 38848972 missense probably damaging 1.00
R1783:Olfr924 UTSW 9 38848972 missense probably damaging 1.00
R1791:Olfr924 UTSW 9 38848605 missense possibly damaging 0.75
R2144:Olfr924 UTSW 9 38848339 missense probably damaging 1.00
R6521:Olfr924 UTSW 9 38848597 missense probably benign
R6808:Olfr924 UTSW 9 38848789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTGTTATTGCAGAAGGCTACCTG -3'
(R):5'- GCTACAGGTGCCAAATGCTTTG -3'

Sequencing Primer
(F):5'- TGCTGACAGCCATGGCCTATG -3'
(R):5'- AACGTCCTTCATTGGAGCG -3'
Posted On2016-11-21