Incidental Mutation 'R5753:Rgs13'
ID444874
Institutional Source Beutler Lab
Gene Symbol Rgs13
Ensembl Gene ENSMUSG00000051079
Gene Nameregulator of G-protein signaling 13
Synonyms
MMRRC Submission 043358-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5753 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location144138654-144177372 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 144140740 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 88 (N88K)
Ref Sequence ENSEMBL: ENSMUSP00000107572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052375] [ENSMUST00000111941]
Predicted Effect probably benign
Transcript: ENSMUST00000052375
AA Change: N88K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000058813
Gene: ENSMUSG00000051079
AA Change: N88K

DomainStartEndE-ValueType
RGS 34 150 1.86e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111941
AA Change: N88K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107572
Gene: ENSMUSG00000051079
AA Change: N88K

DomainStartEndE-ValueType
RGS 34 150 1.86e-45 SMART
Meta Mutation Damage Score 0.1384 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the regulator of G protein signaling (RGS) family. RGS family members share similarity with S. cerevisiae SST2 and C. elegans egl-10 proteins, which contain a characteristic conserved RGS domain. RGS proteins accelerate GTPase activity of G protein alpha-subunits, thereby driving G protein into their inactive GDP-bound form, thus negatively regulating G protein signaling. RGS proteins have been implicated in the fine tuning of a variety of cellular events in response to G protein-coupled receptor activation. The biological function of this gene, however, is unknown. Two transcript variants encoding the same isoform exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased mast cell degranulation and increased anaphylaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik C T 5: 87,972,515 T377I probably damaging Het
Abcb1a A G 5: 8,723,160 D796G probably damaging Het
Actn3 T C 19: 4,864,567 probably null Het
Ada A T 2: 163,735,398 S57T probably benign Het
Adamts6 A G 13: 104,347,350 Y359C probably damaging Het
Adcy1 A T 11: 7,130,300 I348F probably damaging Het
Ankrd11 T C 8: 122,895,304 E603G possibly damaging Het
Bcas3 A G 11: 85,822,084 probably benign Het
Cldn1 C A 16: 26,363,121 V113L probably benign Het
Dock9 T C 14: 121,634,625 T540A probably benign Het
Erp27 A G 6: 136,919,877 F109S probably damaging Het
F13a1 G A 13: 36,898,108 Q541* probably null Het
Fam124a T C 14: 62,606,539 S499P probably benign Het
Fgd3 T A 13: 49,274,940 E486V possibly damaging Het
Flnc T C 6: 29,433,489 S11P probably benign Het
Gm12508 C A 4: 55,254,787 noncoding transcript Het
Grk2 C T 19: 4,290,468 R295H probably damaging Het
Gtf2ird1 A G 5: 134,410,983 M131T probably damaging Het
Hist1h4d G A 13: 23,581,604 M1I probably null Het
Itpripl2 A G 7: 118,491,009 V109A probably damaging Het
Jakmip2 T C 18: 43,559,116 E585G probably damaging Het
Kbtbd3 A T 9: 4,331,404 I593F possibly damaging Het
Lgr4 C T 2: 110,002,512 Q316* probably null Het
Mcf2l T C 8: 12,999,993 F305S probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr1143 A T 2: 87,803,252 M288L probably benign Het
Olfr1264 T C 2: 90,021,503 T188A possibly damaging Het
Olfr1301 T A 2: 111,754,801 I184K possibly damaging Het
Olfr19 A T 16: 16,673,620 Y120* probably null Het
Olfr64 A G 7: 103,893,201 L178P probably damaging Het
Olfr73 G A 2: 88,034,576 L188F probably damaging Het
Olfr735 T A 14: 50,345,588 T285S probably damaging Het
Pcdh9 T A 14: 93,888,161 D191V probably damaging Het
Pde4d T A 13: 109,772,722 probably benign Het
Phkb C T 8: 85,878,230 A88V probably damaging Het
Plec A G 15: 76,173,420 S4128P probably damaging Het
Plekha5 A T 6: 140,537,004 probably null Het
Rho T A 6: 115,935,487 I104N probably damaging Het
Rnps1 T C 17: 24,418,164 probably benign Het
Slc10a7 G T 8: 78,525,299 probably null Het
Slc39a7 C T 17: 34,030,176 R246K probably damaging Het
Sort1 G C 3: 108,345,774 G510A probably damaging Het
Spag6l A G 16: 16,766,967 probably null Het
Sync T A 4: 129,293,386 Y70* probably null Het
Tex45 A T 8: 3,484,112 I350L probably benign Het
Timm8a2 T C 14: 122,034,877 V64A probably benign Het
Tnfrsf11b C A 15: 54,254,059 V267L possibly damaging Het
Trim30b A G 7: 104,357,337 V104A possibly damaging Het
Tusc3 T C 8: 39,096,946 S244P probably damaging Het
Usp16 T A 16: 87,482,899 Y746N probably damaging Het
Vax1 G T 19: 59,166,382 H274Q probably benign Het
Vmn2r108 A G 17: 20,462,917 V675A probably damaging Het
Vmn2r12 A T 5: 109,091,804 W298R probably damaging Het
Zfp948 A G 17: 21,586,894 N116S probably damaging Het
Zkscan2 A G 7: 123,480,700 V678A probably benign Het
Other mutations in Rgs13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Rgs13 APN 1 144171414 splice site probably benign
IGL01314:Rgs13 APN 1 144171441 missense probably benign
R3876:Rgs13 UTSW 1 144140790 nonsense probably null
R4574:Rgs13 UTSW 1 144140845 missense probably damaging 1.00
R4878:Rgs13 UTSW 1 144171479 start codon destroyed probably null 0.97
R5359:Rgs13 UTSW 1 144139584 missense probably damaging 1.00
R5504:Rgs13 UTSW 1 144139620 missense possibly damaging 0.91
R6490:Rgs13 UTSW 1 144140838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGATGACTCTACCACACAGGG -3'
(R):5'- AGAGCTCTTCTTTGGGCTTC -3'

Sequencing Primer
(F):5'- TCTACCACACAGGGGGATTTCATAG -3'
(R):5'- CTTCTTTGGGCTTCTGTATTAAACTG -3'
Posted On2016-11-21