Incidental Mutation 'R5753:Nos1ap'
ID444875
Institutional Source Beutler Lab
Gene Symbol Nos1ap
Ensembl Gene ENSMUSG00000038473
Gene Namenitric oxide synthase 1 (neuronal) adaptor protein
Synonyms6330408P19Rik
MMRRC Submission 043358-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5753 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location170302668-170589861 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 170349399 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 145 (K145M)
Ref Sequence ENSEMBL: ENSMUSP00000124240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160456] [ENSMUST00000160466] [ENSMUST00000161485] [ENSMUST00000161966]
Predicted Effect probably damaging
Transcript: ENSMUST00000160456
AA Change: K145M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125251
Gene: ENSMUSG00000038473
AA Change: K145M

DomainStartEndE-ValueType
PTB 27 173 3.59e-42 SMART
low complexity region 266 313 N/A INTRINSIC
low complexity region 316 330 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160466
AA Change: K91M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125687
Gene: ENSMUSG00000038473
AA Change: K91M

DomainStartEndE-ValueType
Pfam:PID 1 116 4e-25 PFAM
low complexity region 212 231 N/A INTRINSIC
low complexity region 236 268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160816
Predicted Effect probably damaging
Transcript: ENSMUST00000161485
AA Change: K96M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124169
Gene: ENSMUSG00000038473
AA Change: K96M

DomainStartEndE-ValueType
Pfam:PID 1 121 3e-26 PFAM
low complexity region 213 228 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161966
AA Change: K145M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124240
Gene: ENSMUSG00000038473
AA Change: K145M

DomainStartEndE-ValueType
PTB 27 173 3.59e-42 SMART
low complexity region 266 285 N/A INTRINSIC
low complexity region 290 322 N/A INTRINSIC
Meta Mutation Damage Score 0.0276 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik C T 5: 87,972,515 T377I probably damaging Het
Abcb1a A G 5: 8,723,160 D796G probably damaging Het
Actn3 T C 19: 4,864,567 probably null Het
Ada A T 2: 163,735,398 S57T probably benign Het
Adamts6 A G 13: 104,347,350 Y359C probably damaging Het
Adcy1 A T 11: 7,130,300 I348F probably damaging Het
Ankrd11 T C 8: 122,895,304 E603G possibly damaging Het
Bcas3 A G 11: 85,822,084 probably benign Het
Cldn1 C A 16: 26,363,121 V113L probably benign Het
Dock9 T C 14: 121,634,625 T540A probably benign Het
Erp27 A G 6: 136,919,877 F109S probably damaging Het
F13a1 G A 13: 36,898,108 Q541* probably null Het
Fam124a T C 14: 62,606,539 S499P probably benign Het
Fgd3 T A 13: 49,274,940 E486V possibly damaging Het
Flnc T C 6: 29,433,489 S11P probably benign Het
Gm12508 C A 4: 55,254,787 noncoding transcript Het
Grk2 C T 19: 4,290,468 R295H probably damaging Het
Gtf2ird1 A G 5: 134,410,983 M131T probably damaging Het
Hist1h4d G A 13: 23,581,604 M1I probably null Het
Itpripl2 A G 7: 118,491,009 V109A probably damaging Het
Jakmip2 T C 18: 43,559,116 E585G probably damaging Het
Kbtbd3 A T 9: 4,331,404 I593F possibly damaging Het
Lgr4 C T 2: 110,002,512 Q316* probably null Het
Mcf2l T C 8: 12,999,993 F305S probably damaging Het
Olfr1143 A T 2: 87,803,252 M288L probably benign Het
Olfr1264 T C 2: 90,021,503 T188A possibly damaging Het
Olfr1301 T A 2: 111,754,801 I184K possibly damaging Het
Olfr19 A T 16: 16,673,620 Y120* probably null Het
Olfr64 A G 7: 103,893,201 L178P probably damaging Het
Olfr73 G A 2: 88,034,576 L188F probably damaging Het
Olfr735 T A 14: 50,345,588 T285S probably damaging Het
Pcdh9 T A 14: 93,888,161 D191V probably damaging Het
Pde4d T A 13: 109,772,722 probably benign Het
Phkb C T 8: 85,878,230 A88V probably damaging Het
Plec A G 15: 76,173,420 S4128P probably damaging Het
Plekha5 A T 6: 140,537,004 probably null Het
Rgs13 A C 1: 144,140,740 N88K probably benign Het
Rho T A 6: 115,935,487 I104N probably damaging Het
Rnps1 T C 17: 24,418,164 probably benign Het
Slc10a7 G T 8: 78,525,299 probably null Het
Slc39a7 C T 17: 34,030,176 R246K probably damaging Het
Sort1 G C 3: 108,345,774 G510A probably damaging Het
Spag6l A G 16: 16,766,967 probably null Het
Sync T A 4: 129,293,386 Y70* probably null Het
Tex45 A T 8: 3,484,112 I350L probably benign Het
Timm8a2 T C 14: 122,034,877 V64A probably benign Het
Tnfrsf11b C A 15: 54,254,059 V267L possibly damaging Het
Trim30b A G 7: 104,357,337 V104A possibly damaging Het
Tusc3 T C 8: 39,096,946 S244P probably damaging Het
Usp16 T A 16: 87,482,899 Y746N probably damaging Het
Vax1 G T 19: 59,166,382 H274Q probably benign Het
Vmn2r108 A G 17: 20,462,917 V675A probably damaging Het
Vmn2r12 A T 5: 109,091,804 W298R probably damaging Het
Zfp948 A G 17: 21,586,894 N116S probably damaging Het
Zkscan2 A G 7: 123,480,700 V678A probably benign Het
Other mutations in Nos1ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Nos1ap APN 1 170514606 splice site probably benign
IGL01151:Nos1ap APN 1 170589276 missense probably damaging 1.00
IGL02056:Nos1ap APN 1 170318623 missense possibly damaging 0.93
IGL02712:Nos1ap APN 1 170329251 missense possibly damaging 0.93
IGL03177:Nos1ap APN 1 170390730 critical splice donor site probably null
R0096:Nos1ap UTSW 1 170329247 missense probably damaging 1.00
R0096:Nos1ap UTSW 1 170329247 missense probably damaging 1.00
R0621:Nos1ap UTSW 1 170318581 missense probably damaging 0.99
R1332:Nos1ap UTSW 1 170349432 missense probably damaging 1.00
R1523:Nos1ap UTSW 1 170338118 missense probably benign 0.03
R1660:Nos1ap UTSW 1 170514637 missense possibly damaging 0.89
R1704:Nos1ap UTSW 1 170338212 missense probably damaging 1.00
R1764:Nos1ap UTSW 1 170318878 missense possibly damaging 0.83
R1905:Nos1ap UTSW 1 170318558 missense possibly damaging 0.70
R2056:Nos1ap UTSW 1 170327646 missense probably damaging 1.00
R2140:Nos1ap UTSW 1 170329166 missense probably damaging 0.97
R2141:Nos1ap UTSW 1 170329166 missense probably damaging 0.97
R3890:Nos1ap UTSW 1 170349456 missense probably damaging 1.00
R3891:Nos1ap UTSW 1 170349456 missense probably damaging 1.00
R3892:Nos1ap UTSW 1 170349456 missense probably damaging 1.00
R4109:Nos1ap UTSW 1 170318668 missense probably benign
R5305:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5306:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5412:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5414:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5444:Nos1ap UTSW 1 170375251 missense probably damaging 1.00
R5636:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5637:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5638:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5754:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5787:Nos1ap UTSW 1 170318572 missense probably benign 0.41
R7060:Nos1ap UTSW 1 170338125 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GGACTAAGCACACAGTTCAGATGAC -3'
(R):5'- AGTGAGCTCTGTCTTCTGCC -3'

Sequencing Primer
(F):5'- GCACACAGTTCAGATGACTCTAAAG -3'
(R):5'- CTCCCGTGAGCAGAGGTTTC -3'
Posted On2016-11-21