Incidental Mutation 'R5753:Tusc3'
ID444899
Institutional Source Beutler Lab
Gene Symbol Tusc3
Ensembl Gene ENSMUSG00000039530
Gene Nametumor suppressor candidate 3
Synonyms
MMRRC Submission 043358-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.692) question?
Stock #R5753 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location39005845-39165114 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39096946 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 244 (S244P)
Ref Sequence ENSEMBL: ENSMUSP00000148134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167992] [ENSMUST00000169034] [ENSMUST00000209440] [ENSMUST00000211241]
Predicted Effect probably damaging
Transcript: ENSMUST00000167992
AA Change: S244P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126080
Gene: ENSMUSG00000039530
AA Change: S244P

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
Pfam:Thioredoxin 64 185 3.7e-7 PFAM
Pfam:OST3_OST6 179 329 1.6e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169034
SMART Domains Protein: ENSMUSP00000129916
Gene: ENSMUSG00000039530

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
PDB:4M90|A 44 102 7e-38 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000209440
AA Change: S244P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000210890
AA Change: S127P
Predicted Effect probably benign
Transcript: ENSMUST00000211241
Meta Mutation Damage Score 0.414 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate tumor suppressor gene. It is located within a homozygously deleted region of a metastatic prostate cancer. The gene is expressed in most nonlymphoid human tissues including prostate, lung, liver, and colon. Expression was also detected in many epithelial tumor cell lines. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik C T 5: 87,972,515 T377I probably damaging Het
Abcb1a A G 5: 8,723,160 D796G probably damaging Het
Actn3 T C 19: 4,864,567 probably null Het
Ada A T 2: 163,735,398 S57T probably benign Het
Adamts6 A G 13: 104,347,350 Y359C probably damaging Het
Adcy1 A T 11: 7,130,300 I348F probably damaging Het
Ankrd11 T C 8: 122,895,304 E603G possibly damaging Het
Bcas3 A G 11: 85,822,084 probably benign Het
Cldn1 C A 16: 26,363,121 V113L probably benign Het
Dock9 T C 14: 121,634,625 T540A probably benign Het
Erp27 A G 6: 136,919,877 F109S probably damaging Het
F13a1 G A 13: 36,898,108 Q541* probably null Het
Fam124a T C 14: 62,606,539 S499P probably benign Het
Fgd3 T A 13: 49,274,940 E486V possibly damaging Het
Flnc T C 6: 29,433,489 S11P probably benign Het
Gm12508 C A 4: 55,254,787 noncoding transcript Het
Grk2 C T 19: 4,290,468 R295H probably damaging Het
Gtf2ird1 A G 5: 134,410,983 M131T probably damaging Het
Hist1h4d G A 13: 23,581,604 M1I probably null Het
Itpripl2 A G 7: 118,491,009 V109A probably damaging Het
Jakmip2 T C 18: 43,559,116 E585G probably damaging Het
Kbtbd3 A T 9: 4,331,404 I593F possibly damaging Het
Lgr4 C T 2: 110,002,512 Q316* probably null Het
Mcf2l T C 8: 12,999,993 F305S probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr1143 A T 2: 87,803,252 M288L probably benign Het
Olfr1264 T C 2: 90,021,503 T188A possibly damaging Het
Olfr1301 T A 2: 111,754,801 I184K possibly damaging Het
Olfr19 A T 16: 16,673,620 Y120* probably null Het
Olfr64 A G 7: 103,893,201 L178P probably damaging Het
Olfr73 G A 2: 88,034,576 L188F probably damaging Het
Olfr735 T A 14: 50,345,588 T285S probably damaging Het
Pcdh9 T A 14: 93,888,161 D191V probably damaging Het
Pde4d T A 13: 109,772,722 probably benign Het
Phkb C T 8: 85,878,230 A88V probably damaging Het
Plec A G 15: 76,173,420 S4128P probably damaging Het
Plekha5 A T 6: 140,537,004 probably null Het
Rgs13 A C 1: 144,140,740 N88K probably benign Het
Rho T A 6: 115,935,487 I104N probably damaging Het
Rnps1 T C 17: 24,418,164 probably benign Het
Slc10a7 G T 8: 78,525,299 probably null Het
Slc39a7 C T 17: 34,030,176 R246K probably damaging Het
Sort1 G C 3: 108,345,774 G510A probably damaging Het
Spag6l A G 16: 16,766,967 probably null Het
Sync T A 4: 129,293,386 Y70* probably null Het
Tex45 A T 8: 3,484,112 I350L probably benign Het
Timm8a2 T C 14: 122,034,877 V64A probably benign Het
Tnfrsf11b C A 15: 54,254,059 V267L possibly damaging Het
Trim30b A G 7: 104,357,337 V104A possibly damaging Het
Usp16 T A 16: 87,482,899 Y746N probably damaging Het
Vax1 G T 19: 59,166,382 H274Q probably benign Het
Vmn2r108 A G 17: 20,462,917 V675A probably damaging Het
Vmn2r12 A T 5: 109,091,804 W298R probably damaging Het
Zfp948 A G 17: 21,586,894 N116S probably damaging Het
Zkscan2 A G 7: 123,480,700 V678A probably benign Het
Other mutations in Tusc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01730:Tusc3 APN 8 39164839 makesense probably null
IGL03247:Tusc3 APN 8 39130777 missense possibly damaging 0.64
R0070:Tusc3 UTSW 8 39063267 missense possibly damaging 0.49
R0594:Tusc3 UTSW 8 39096968 missense probably damaging 1.00
R1648:Tusc3 UTSW 8 39046567 nonsense probably null
R3615:Tusc3 UTSW 8 39164838 missense probably damaging 0.97
R3616:Tusc3 UTSW 8 39164838 missense probably damaging 0.97
R5502:Tusc3 UTSW 8 39130793 nonsense probably null
R5723:Tusc3 UTSW 8 39071497 missense possibly damaging 0.75
R6004:Tusc3 UTSW 8 39071406 missense probably damaging 0.99
R6030:Tusc3 UTSW 8 39071406 missense probably damaging 0.99
R6030:Tusc3 UTSW 8 39071406 missense probably damaging 0.99
R7162:Tusc3 UTSW 8 39126587 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGTAATTTGCTCAGGATCCTATAGG -3'
(R):5'- TGCTTTCAGTAGGGTGCAC -3'

Sequencing Primer
(F):5'- TCCTGGGAACTGATACATG -3'
(R):5'- GGGTGCACAATTTTATGAAGTCATG -3'
Posted On2016-11-21