Incidental Mutation 'R5753:Pde4d'
ID444908
Institutional Source Beutler Lab
Gene Symbol Pde4d
Ensembl Gene ENSMUSG00000021699
Gene Namephosphodiesterase 4D, cAMP specific
Synonymsdunce, Dpde3, 9630011N22Rik
MMRRC Submission 043358-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5753 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location108449948-109953461 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 109772722 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074103] [ENSMUST00000079975] [ENSMUST00000119507] [ENSMUST00000120671] [ENSMUST00000122041] [ENSMUST00000135275] [ENSMUST00000177907]
Predicted Effect probably benign
Transcript: ENSMUST00000074103
SMART Domains Protein: ENSMUSP00000073742
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
HDc 329 504 1.12e-2 SMART
low complexity region 652 667 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079975
SMART Domains Protein: ENSMUSP00000078891
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
HDc 349 524 1.12e-2 SMART
low complexity region 672 687 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119507
SMART Domains Protein: ENSMUSP00000114089
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
HDc 354 529 1.12e-2 SMART
low complexity region 677 692 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120671
SMART Domains Protein: ENSMUSP00000112991
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
low complexity region 45 84 N/A INTRINSIC
HDc 454 629 1.12e-2 SMART
low complexity region 777 792 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122041
SMART Domains Protein: ENSMUSP00000113488
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
HDc 398 573 1.12e-2 SMART
low complexity region 721 736 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134973
Predicted Effect probably benign
Transcript: ENSMUST00000135275
SMART Domains Protein: ENSMUSP00000119583
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
HDc 351 526 1.12e-2 SMART
low complexity region 674 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138938
Predicted Effect probably benign
Transcript: ENSMUST00000153234
SMART Domains Protein: ENSMUSP00000121592
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
PDB:1E9K|A 22 59 9e-18 PDB
low complexity region 69 85 N/A INTRINSIC
HDc 405 580 1.12e-2 SMART
low complexity region 728 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177907
SMART Domains Protein: ENSMUSP00000136485
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
HDc 398 573 1.12e-2 SMART
low complexity region 721 736 N/A INTRINSIC
Meta Mutation Damage Score 0.0732 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (58/60)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit delayed growth, female infertility associated with impaired ovulation, and reduced postnatal viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik C T 5: 87,972,515 T377I probably damaging Het
Abcb1a A G 5: 8,723,160 D796G probably damaging Het
Actn3 T C 19: 4,864,567 probably null Het
Ada A T 2: 163,735,398 S57T probably benign Het
Adamts6 A G 13: 104,347,350 Y359C probably damaging Het
Adcy1 A T 11: 7,130,300 I348F probably damaging Het
Ankrd11 T C 8: 122,895,304 E603G possibly damaging Het
Bcas3 A G 11: 85,822,084 probably benign Het
Cldn1 C A 16: 26,363,121 V113L probably benign Het
Dock9 T C 14: 121,634,625 T540A probably benign Het
Erp27 A G 6: 136,919,877 F109S probably damaging Het
F13a1 G A 13: 36,898,108 Q541* probably null Het
Fam124a T C 14: 62,606,539 S499P probably benign Het
Fgd3 T A 13: 49,274,940 E486V possibly damaging Het
Flnc T C 6: 29,433,489 S11P probably benign Het
Gm12508 C A 4: 55,254,787 noncoding transcript Het
Grk2 C T 19: 4,290,468 R295H probably damaging Het
Gtf2ird1 A G 5: 134,410,983 M131T probably damaging Het
Hist1h4d G A 13: 23,581,604 M1I probably null Het
Itpripl2 A G 7: 118,491,009 V109A probably damaging Het
Jakmip2 T C 18: 43,559,116 E585G probably damaging Het
Kbtbd3 A T 9: 4,331,404 I593F possibly damaging Het
Lgr4 C T 2: 110,002,512 Q316* probably null Het
Mcf2l T C 8: 12,999,993 F305S probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr1143 A T 2: 87,803,252 M288L probably benign Het
Olfr1264 T C 2: 90,021,503 T188A possibly damaging Het
Olfr1301 T A 2: 111,754,801 I184K possibly damaging Het
Olfr19 A T 16: 16,673,620 Y120* probably null Het
Olfr64 A G 7: 103,893,201 L178P probably damaging Het
Olfr73 G A 2: 88,034,576 L188F probably damaging Het
Olfr735 T A 14: 50,345,588 T285S probably damaging Het
Pcdh9 T A 14: 93,888,161 D191V probably damaging Het
Phkb C T 8: 85,878,230 A88V probably damaging Het
Plec A G 15: 76,173,420 S4128P probably damaging Het
Plekha5 A T 6: 140,537,004 probably null Het
Rgs13 A C 1: 144,140,740 N88K probably benign Het
Rho T A 6: 115,935,487 I104N probably damaging Het
Rnps1 T C 17: 24,418,164 probably benign Het
Slc10a7 G T 8: 78,525,299 probably null Het
Slc39a7 C T 17: 34,030,176 R246K probably damaging Het
Sort1 G C 3: 108,345,774 G510A probably damaging Het
Spag6l A G 16: 16,766,967 probably null Het
Sync T A 4: 129,293,386 Y70* probably null Het
Tex45 A T 8: 3,484,112 I350L probably benign Het
Timm8a2 T C 14: 122,034,877 V64A probably benign Het
Tnfrsf11b C A 15: 54,254,059 V267L possibly damaging Het
Trim30b A G 7: 104,357,337 V104A possibly damaging Het
Tusc3 T C 8: 39,096,946 S244P probably damaging Het
Usp16 T A 16: 87,482,899 Y746N probably damaging Het
Vax1 G T 19: 59,166,382 H274Q probably benign Het
Vmn2r108 A G 17: 20,462,917 V675A probably damaging Het
Vmn2r12 A T 5: 109,091,804 W298R probably damaging Het
Zfp948 A G 17: 21,586,894 N116S probably damaging Het
Zkscan2 A G 7: 123,480,700 V678A probably benign Het
Other mutations in Pde4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Pde4d APN 13 109936687 missense possibly damaging 0.69
IGL00792:Pde4d APN 13 109935395 missense possibly damaging 0.85
IGL01014:Pde4d APN 13 109949502 missense probably damaging 1.00
IGL01660:Pde4d APN 13 109938072 missense probably damaging 1.00
IGL02233:Pde4d APN 13 109740550 missense probably damaging 1.00
IGL02405:Pde4d APN 13 108860209 critical splice donor site probably null
IGL02544:Pde4d APN 13 109740523 missense probably damaging 1.00
IGL02885:Pde4d APN 13 109948261 missense probably damaging 1.00
IGL03286:Pde4d APN 13 109954506 unclassified probably benign
IGL03406:Pde4d APN 13 109954591 unclassified probably benign
Heliosphere UTSW 13 109116942 missense probably benign
Stubbs UTSW 13 109772722 intron probably benign
IGL03055:Pde4d UTSW 13 109935345 missense probably damaging 1.00
R0020:Pde4d UTSW 13 109954570 missense possibly damaging 0.66
R0020:Pde4d UTSW 13 109954570 missense possibly damaging 0.66
R0054:Pde4d UTSW 13 109740421 missense probably benign 0.23
R0054:Pde4d UTSW 13 109740421 missense probably benign 0.23
R0357:Pde4d UTSW 13 109951268 missense possibly damaging 0.46
R0482:Pde4d UTSW 13 109936710 missense probably benign 0.00
R0689:Pde4d UTSW 13 109740544 missense possibly damaging 0.78
R0884:Pde4d UTSW 13 109950940 missense probably damaging 0.99
R1169:Pde4d UTSW 13 109950928 splice site probably null
R1225:Pde4d UTSW 13 109950221 missense probably benign 0.04
R1246:Pde4d UTSW 13 109950973 missense probably damaging 1.00
R1344:Pde4d UTSW 13 109950387 nonsense probably null
R1351:Pde4d UTSW 13 109951275 missense possibly damaging 0.46
R1371:Pde4d UTSW 13 109117061 missense probably benign 0.00
R1418:Pde4d UTSW 13 109950387 nonsense probably null
R2197:Pde4d UTSW 13 109948390 missense probably damaging 1.00
R2440:Pde4d UTSW 13 109927197 intron probably benign
R3114:Pde4d UTSW 13 109948258 missense probably damaging 1.00
R3115:Pde4d UTSW 13 109948258 missense probably damaging 1.00
R3722:Pde4d UTSW 13 109951332 nonsense probably null
R3742:Pde4d UTSW 13 109740479 missense probably benign 0.42
R3797:Pde4d UTSW 13 109632897 missense probably benign 0.29
R3983:Pde4d UTSW 13 109740406 missense probably benign 0.23
R4618:Pde4d UTSW 13 109933877 missense probably benign 0.13
R4768:Pde4d UTSW 13 109933874 missense probably damaging 1.00
R4795:Pde4d UTSW 13 109938171 intron probably benign
R4824:Pde4d UTSW 13 109116866 missense probably benign 0.00
R4942:Pde4d UTSW 13 108860199 missense probably benign 0.00
R4984:Pde4d UTSW 13 109740464 missense probably damaging 1.00
R5180:Pde4d UTSW 13 109740473 missense probably benign 0.13
R5267:Pde4d UTSW 13 109260809 intron probably benign
R5311:Pde4d UTSW 13 109632864 missense probably benign 0.02
R5311:Pde4d UTSW 13 109632865 missense probably benign
R5376:Pde4d UTSW 13 109772644 missense probably benign 0.00
R5551:Pde4d UTSW 13 109948396 critical splice donor site probably null
R5754:Pde4d UTSW 13 109938013 missense probably damaging 0.98
R5838:Pde4d UTSW 13 109740442 missense probably damaging 0.99
R5864:Pde4d UTSW 13 109938048 missense probably benign 0.00
R6039:Pde4d UTSW 13 109948342 missense probably damaging 1.00
R6039:Pde4d UTSW 13 109948342 missense probably damaging 1.00
R6049:Pde4d UTSW 13 109032585 nonsense probably null
R6214:Pde4d UTSW 13 109949433 missense probably damaging 1.00
R6215:Pde4d UTSW 13 109949433 missense probably damaging 1.00
R6273:Pde4d UTSW 13 109950221 missense possibly damaging 0.94
R6431:Pde4d UTSW 13 109601786 unclassified probably null
R6501:Pde4d UTSW 13 109116942 missense probably benign
R6534:Pde4d UTSW 13 109632901 missense probably benign 0.05
R6709:Pde4d UTSW 13 109948279 missense probably damaging 1.00
R6722:Pde4d UTSW 13 109632898 nonsense probably null
R7164:Pde4d UTSW 13 109032688 missense probably benign
R7222:Pde4d UTSW 13 109757579 missense probably damaging 1.00
R7489:Pde4d UTSW 13 109116767 missense unknown
R7563:Pde4d UTSW 13 109951007 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CTTTCAATTAGAATGGCAGACGG -3'
(R):5'- TTCCCAAGGAATCGCAGAAGC -3'

Sequencing Primer
(F):5'- ACGGAAAACAACTTAGGTTACTG -3'
(R):5'- GGAGACAGCATTTCTCAACCTGTG -3'
Posted On2016-11-21