Incidental Mutation 'R5753:Cldn1'
ID444917
Institutional Source Beutler Lab
Gene Symbol Cldn1
Ensembl Gene ENSMUSG00000022512
Gene Nameclaudin 1
Synonyms
MMRRC Submission 043358-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5753 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location26356642-26371841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 26363121 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 113 (V113L)
Ref Sequence ENSEMBL: ENSMUSP00000023154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023154]
Predicted Effect probably benign
Transcript: ENSMUST00000023154
AA Change: V113L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000023154
Gene: ENSMUSG00000022512
AA Change: V113L

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 182 2e-54 PFAM
Pfam:Claudin_2 15 184 4.4e-10 PFAM
low complexity region 187 205 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232215
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The knockout mice lacking this gene die soon after birth as a consequence of dehydration from trandermal water loss, indicating that this gene is indispensable for creating and maintaining the epidermal barrier. The protein encoded by this gene also has gastric tumor suppressive activity, and is a key factor for hepatitis C virus (HCV) entry. [provided by RefSeq, Aug 2010]
PHENOTYPE: Animals homozygous for a mutation in this gene have wrinkled skin and die within 1 day after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik C T 5: 87,972,515 T377I probably damaging Het
Abcb1a A G 5: 8,723,160 D796G probably damaging Het
Actn3 T C 19: 4,864,567 probably null Het
Ada A T 2: 163,735,398 S57T probably benign Het
Adamts6 A G 13: 104,347,350 Y359C probably damaging Het
Adcy1 A T 11: 7,130,300 I348F probably damaging Het
Ankrd11 T C 8: 122,895,304 E603G possibly damaging Het
Bcas3 A G 11: 85,822,084 probably benign Het
Dock9 T C 14: 121,634,625 T540A probably benign Het
Erp27 A G 6: 136,919,877 F109S probably damaging Het
F13a1 G A 13: 36,898,108 Q541* probably null Het
Fam124a T C 14: 62,606,539 S499P probably benign Het
Fgd3 T A 13: 49,274,940 E486V possibly damaging Het
Flnc T C 6: 29,433,489 S11P probably benign Het
Gm12508 C A 4: 55,254,787 noncoding transcript Het
Grk2 C T 19: 4,290,468 R295H probably damaging Het
Gtf2ird1 A G 5: 134,410,983 M131T probably damaging Het
Hist1h4d G A 13: 23,581,604 M1I probably null Het
Itpripl2 A G 7: 118,491,009 V109A probably damaging Het
Jakmip2 T C 18: 43,559,116 E585G probably damaging Het
Kbtbd3 A T 9: 4,331,404 I593F possibly damaging Het
Lgr4 C T 2: 110,002,512 Q316* probably null Het
Mcf2l T C 8: 12,999,993 F305S probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr1143 A T 2: 87,803,252 M288L probably benign Het
Olfr1264 T C 2: 90,021,503 T188A possibly damaging Het
Olfr1301 T A 2: 111,754,801 I184K possibly damaging Het
Olfr19 A T 16: 16,673,620 Y120* probably null Het
Olfr64 A G 7: 103,893,201 L178P probably damaging Het
Olfr73 G A 2: 88,034,576 L188F probably damaging Het
Olfr735 T A 14: 50,345,588 T285S probably damaging Het
Pcdh9 T A 14: 93,888,161 D191V probably damaging Het
Pde4d T A 13: 109,772,722 probably benign Het
Phkb C T 8: 85,878,230 A88V probably damaging Het
Plec A G 15: 76,173,420 S4128P probably damaging Het
Plekha5 A T 6: 140,537,004 probably null Het
Rgs13 A C 1: 144,140,740 N88K probably benign Het
Rho T A 6: 115,935,487 I104N probably damaging Het
Rnps1 T C 17: 24,418,164 probably benign Het
Slc10a7 G T 8: 78,525,299 probably null Het
Slc39a7 C T 17: 34,030,176 R246K probably damaging Het
Sort1 G C 3: 108,345,774 G510A probably damaging Het
Spag6l A G 16: 16,766,967 probably null Het
Sync T A 4: 129,293,386 Y70* probably null Het
Tex45 A T 8: 3,484,112 I350L probably benign Het
Timm8a2 T C 14: 122,034,877 V64A probably benign Het
Tnfrsf11b C A 15: 54,254,059 V267L possibly damaging Het
Trim30b A G 7: 104,357,337 V104A possibly damaging Het
Tusc3 T C 8: 39,096,946 S244P probably damaging Het
Usp16 T A 16: 87,482,899 Y746N probably damaging Het
Vax1 G T 19: 59,166,382 H274Q probably benign Het
Vmn2r108 A G 17: 20,462,917 V675A probably damaging Het
Vmn2r12 A T 5: 109,091,804 W298R probably damaging Het
Zfp948 A G 17: 21,586,894 N116S probably damaging Het
Zkscan2 A G 7: 123,480,700 V678A probably benign Het
Other mutations in Cldn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01471:Cldn1 APN 16 26371572 missense possibly damaging 0.59
IGL02937:Cldn1 APN 16 26360873 missense probably damaging 1.00
R1626:Cldn1 UTSW 16 26371452 missense probably damaging 1.00
R2131:Cldn1 UTSW 16 26371550 missense probably damaging 0.98
R2264:Cldn1 UTSW 16 26359199 missense probably damaging 1.00
R3778:Cldn1 UTSW 16 26371466 missense probably damaging 1.00
R4850:Cldn1 UTSW 16 26363163 missense probably benign 0.04
R5711:Cldn1 UTSW 16 26371417 missense probably damaging 1.00
R6017:Cldn1 UTSW 16 26363219 missense probably damaging 1.00
R7134:Cldn1 UTSW 16 26371626 start codon destroyed probably null 0.98
R7199:Cldn1 UTSW 16 26371596 missense probably benign 0.06
R7373:Cldn1 UTSW 16 26360856 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTCATGTCTTCAGATGGTAG -3'
(R):5'- TGGCTACGGCAGAAATGTCAC -3'

Sequencing Primer
(F):5'- CCTTGATTTCAAACCACAC -3'
(R):5'- CTACGGCAGAAATGTCACTAGAGTTC -3'
Posted On2016-11-21