Incidental Mutation 'R0027:Setx'
ID44493
Institutional Source Beutler Lab
Gene Symbol Setx
Ensembl Gene ENSMUSG00000043535
Gene Namesenataxin
SynonymsA930037J23Rik, Als4
MMRRC Submission 038322-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0027 (G1) of strain 730
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location29124181-29182471 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 29139221 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 167 (V167G)
Ref Sequence ENSEMBL: ENSMUSP00000051492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061578]
Predicted Effect probably damaging
Transcript: ENSMUST00000061578
AA Change: V167G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000051492
Gene: ENSMUSG00000043535
AA Change: V167G

DomainStartEndE-ValueType
low complexity region 864 876 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
low complexity region 1058 1079 N/A INTRINSIC
low complexity region 1575 1594 N/A INTRINSIC
Pfam:AAA_11 1909 2194 1.9e-68 PFAM
Pfam:AAA_19 1924 2015 2.9e-11 PFAM
Pfam:AAA_12 2201 2402 1.1e-54 PFAM
low complexity region 2499 2516 N/A INTRINSIC
low complexity region 2576 2587 N/A INTRINSIC
Meta Mutation Damage Score 0.208 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein named for its homology to the Sen1p protein of fungi which has RNA helicase activity encoded by a domain at the C-terminal end of the protein. The protein encoded by this gene contains a DNA/RNA helicase domain at its C-terminal end which suggests that it may be involved in both DNA and RNA processing. Mutations in this gene have been associated with ataxia-ocular apraxia-2 (AOA2) and an autosomal dominant form of juvenile amyotrophic lateral sclerosis (ALS4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility due to arrested male meiosis and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A T 15: 11,285,873 I723F probably damaging Het
Anapc1 G T 2: 128,641,511 D1221E possibly damaging Het
Arhgef28 T A 13: 97,945,696 E1201V possibly damaging Het
Capn12 T A 7: 28,881,960 H79Q probably benign Het
Caprin1 A T 2: 103,775,580 probably benign Het
Carmil3 T A 14: 55,494,403 F196Y probably damaging Het
Casp8ap2 A G 4: 32,643,810 H961R probably benign Het
Cdkl3 C T 11: 52,032,349 probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Col13a1 A G 10: 61,850,161 L684P unknown Het
D10Wsu102e G A 10: 83,364,529 probably benign Het
D430041D05Rik A T 2: 104,255,044 F1053L probably benign Het
Dab1 T C 4: 104,704,199 probably benign Het
Dmxl1 A T 18: 49,957,295 probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
E130309D02Rik G A 5: 143,308,062 T220I probably damaging Het
Eml1 T C 12: 108,536,298 C708R possibly damaging Het
Fam131b T A 6: 42,318,248 M304L probably benign Het
Foxk1 A T 5: 142,450,340 I321F probably damaging Het
Gm10306 C T 4: 94,556,790 probably benign Het
Gm10985 TA TANA 3: 53,845,256 probably null Het
Gse1 T C 8: 120,566,546 probably benign Het
Hcn3 A G 3: 89,159,825 S79P probably damaging Het
Hspa4 T A 11: 53,283,585 M203L probably benign Het
Kctd7 G A 5: 130,152,573 R279H probably damaging Het
Kif11 C T 19: 37,406,983 probably benign Het
Klf13 T C 7: 63,891,761 N206S probably benign Het
Kpna7 A T 5: 144,989,697 Y482N probably damaging Het
Lamc1 T C 1: 153,262,583 Y175C probably damaging Het
Lrpprc G A 17: 84,767,007 R491* probably null Het
Madd T A 2: 91,152,549 I1350F probably damaging Het
Mbtd1 T C 11: 93,924,549 V321A possibly damaging Het
Mon2 G A 10: 123,036,048 S357L possibly damaging Het
Ndst3 A G 3: 123,671,513 V270A probably damaging Het
Nlrp2 T C 7: 5,322,448 T742A probably damaging Het
Olfr214 T C 6: 116,556,949 S175P probably damaging Het
Papola A C 12: 105,833,136 S675R probably benign Het
Pcdh9 T A 14: 93,888,645 I30F probably null Het
Prl6a1 T A 13: 27,318,028 L126Q probably damaging Het
Prr29 A G 11: 106,376,276 E89G possibly damaging Het
Psmd1 T C 1: 86,094,265 probably benign Het
Rad9b A G 5: 122,351,723 probably benign Het
Rest T C 5: 77,282,551 V939A probably benign Het
Rnf135 T A 11: 80,193,942 S180R probably benign Het
Sarm1 C A 11: 78,488,091 R376L probably damaging Het
Scap C A 9: 110,379,730 P613Q probably benign Het
Scube3 C T 17: 28,164,357 R374* probably null Het
Snrnp40 T A 4: 130,368,273 H151Q probably damaging Het
Sox21 G T 14: 118,235,617 H7N probably benign Het
Stard9 A T 2: 120,703,501 Q3413L probably benign Het
Sycp1 A G 3: 102,895,910 V528A probably benign Het
Tcl1b3 A T 12: 105,191,239 S47C probably damaging Het
Treml4 T C 17: 48,264,934 S122P possibly damaging Het
Trip11 C T 12: 101,885,169 A879T probably benign Het
Ubr4 C A 4: 139,400,393 N567K probably damaging Het
Zan T C 5: 137,406,519 probably benign Het
Zfp804a G A 2: 82,257,200 D458N probably damaging Het
Zic2 T C 14: 122,476,343 M223T possibly damaging Het
Other mutations in Setx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Setx APN 2 29148445 missense possibly damaging 0.50
IGL00806:Setx APN 2 29127026 missense probably damaging 1.00
IGL01346:Setx APN 2 29144809 missense probably damaging 1.00
IGL01623:Setx APN 2 29163009 missense possibly damaging 0.70
IGL02351:Setx APN 2 29146964 missense probably benign 0.45
IGL02358:Setx APN 2 29146964 missense probably benign 0.45
IGL02378:Setx APN 2 29173726 splice site probably benign
IGL02388:Setx APN 2 29173653 missense probably damaging 1.00
IGL02408:Setx APN 2 29133930 missense probably damaging 1.00
IGL02425:Setx APN 2 29148408 missense probably benign 0.00
IGL03023:Setx APN 2 29145902 missense probably benign 0.02
IGL03351:Setx APN 2 29161799 missense probably benign 0.25
addison UTSW 2 29158905 missense probably damaging 1.00
dallas UTSW 2 29154061 frame shift probably null
doggie UTSW 2 29164550 missense probably damaging 1.00
Irving UTSW 2 29139221 missense probably damaging 0.99
IGL03014:Setx UTSW 2 29139411 missense probably damaging 1.00
R0031:Setx UTSW 2 29176929 missense probably benign 0.02
R0070:Setx UTSW 2 29161525 missense probably benign 0.00
R0070:Setx UTSW 2 29161525 missense probably benign 0.00
R0092:Setx UTSW 2 29146293 missense probably benign 0.00
R0193:Setx UTSW 2 29179673 missense probably benign 0.21
R0281:Setx UTSW 2 29179643 missense probably benign 0.00
R0401:Setx UTSW 2 29166289 nonsense probably null
R0413:Setx UTSW 2 29139278 missense probably damaging 1.00
R0517:Setx UTSW 2 29157133 missense probably benign 0.00
R0536:Setx UTSW 2 29158248 missense possibly damaging 0.46
R0617:Setx UTSW 2 29146807 missense possibly damaging 0.86
R1183:Setx UTSW 2 29180092 missense probably benign
R1331:Setx UTSW 2 29179686 missense probably benign
R1465:Setx UTSW 2 29140389 critical splice donor site probably null
R1465:Setx UTSW 2 29140389 critical splice donor site probably null
R1467:Setx UTSW 2 29158905 missense probably damaging 1.00
R1467:Setx UTSW 2 29158905 missense probably damaging 1.00
R1482:Setx UTSW 2 29162992 missense probably damaging 0.99
R1599:Setx UTSW 2 29140373 missense probably benign 0.04
R1663:Setx UTSW 2 29126905 missense probably damaging 1.00
R1909:Setx UTSW 2 29163009 missense possibly damaging 0.70
R2117:Setx UTSW 2 29130301 missense probably benign 0.01
R2207:Setx UTSW 2 29154061 frame shift probably null
R2221:Setx UTSW 2 29154061 frame shift probably null
R2223:Setx UTSW 2 29148537 missense possibly damaging 0.89
R2223:Setx UTSW 2 29154061 frame shift probably null
R2273:Setx UTSW 2 29154061 frame shift probably null
R2274:Setx UTSW 2 29154061 frame shift probably null
R2275:Setx UTSW 2 29154061 frame shift probably null
R2309:Setx UTSW 2 29158904 missense probably damaging 1.00
R2328:Setx UTSW 2 29154060 frame shift probably null
R2328:Setx UTSW 2 29154061 frame shift probably null
R2329:Setx UTSW 2 29154061 frame shift probably null
R2331:Setx UTSW 2 29154061 frame shift probably null
R2332:Setx UTSW 2 29154061 frame shift probably null
R2429:Setx UTSW 2 29179898 missense probably benign 0.00
R2438:Setx UTSW 2 29154061 frame shift probably null
R2439:Setx UTSW 2 29154061 frame shift probably null
R2496:Setx UTSW 2 29144801 missense probably benign 0.11
R2858:Setx UTSW 2 29154061 frame shift probably null
R2859:Setx UTSW 2 29154061 frame shift probably null
R2884:Setx UTSW 2 29148625 missense probably damaging 0.98
R2885:Setx UTSW 2 29148625 missense probably damaging 0.98
R2886:Setx UTSW 2 29148625 missense probably damaging 0.98
R2915:Setx UTSW 2 29172324 missense probably damaging 0.99
R2921:Setx UTSW 2 29154060 small deletion probably benign
R2921:Setx UTSW 2 29154061 frame shift probably null
R2923:Setx UTSW 2 29154061 frame shift probably null
R3426:Setx UTSW 2 29154061 frame shift probably null
R3609:Setx UTSW 2 29154061 frame shift probably null
R3610:Setx UTSW 2 29154061 frame shift probably null
R3731:Setx UTSW 2 29154061 frame shift probably null
R3813:Setx UTSW 2 29154061 frame shift probably null
R3835:Setx UTSW 2 29145060 missense possibly damaging 0.81
R3871:Setx UTSW 2 29145741 missense probably damaging 0.98
R4013:Setx UTSW 2 29154061 frame shift probably null
R4014:Setx UTSW 2 29154061 frame shift probably null
R4015:Setx UTSW 2 29154061 frame shift probably null
R4017:Setx UTSW 2 29154061 frame shift probably null
R4246:Setx UTSW 2 29154061 frame shift probably null
R4248:Setx UTSW 2 29154061 frame shift probably null
R4297:Setx UTSW 2 29154061 frame shift probably null
R4298:Setx UTSW 2 29154061 frame shift probably null
R4539:Setx UTSW 2 29179748 missense probably benign 0.14
R4590:Setx UTSW 2 29144809 missense probably damaging 1.00
R4632:Setx UTSW 2 29148615 missense probably benign 0.23
R4782:Setx UTSW 2 29144046 missense probably damaging 0.99
R4801:Setx UTSW 2 29146373 missense probably benign 0.14
R4802:Setx UTSW 2 29146373 missense probably benign 0.14
R4975:Setx UTSW 2 29164550 missense probably damaging 1.00
R5040:Setx UTSW 2 29139338 missense probably damaging 1.00
R5133:Setx UTSW 2 29180081 missense probably benign 0.02
R5208:Setx UTSW 2 29166367 missense possibly damaging 0.63
R5237:Setx UTSW 2 29146983 missense probably benign 0.00
R5248:Setx UTSW 2 29148418 missense probably benign 0.26
R5288:Setx UTSW 2 29134033 critical splice donor site probably null
R5385:Setx UTSW 2 29134033 critical splice donor site probably null
R5387:Setx UTSW 2 29147594 missense probably benign 0.00
R5407:Setx UTSW 2 29145474 missense probably benign 0.00
R5685:Setx UTSW 2 29171280 missense probably damaging 1.00
R6110:Setx UTSW 2 29140290 missense probably damaging 1.00
R6136:Setx UTSW 2 29148027 missense probably benign 0.01
R6310:Setx UTSW 2 29176935 missense possibly damaging 0.57
R6328:Setx UTSW 2 29174462 intron probably benign
R6358:Setx UTSW 2 29171348 missense possibly damaging 0.79
R6384:Setx UTSW 2 29173558 missense probably damaging 1.00
R6400:Setx UTSW 2 29130274 missense probably damaging 0.97
R6572:Setx UTSW 2 29173694 missense possibly damaging 0.63
R6662:Setx UTSW 2 29158114 missense probably damaging 0.97
R6898:Setx UTSW 2 29148108 missense probably benign 0.00
X0066:Setx UTSW 2 29147879 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGTCGTGGTAGATGGAAATGACCAA -3'
(R):5'- CATGTGTGCAGGCAAAAGGATCAG -3'

Sequencing Primer
(F):5'- CATAGAACAGGTTCCTGCTAGTC -3'
(R):5'- AGTTTGCCTTTTTCAAGCACAG -3'
Posted On2013-06-11