Incidental Mutation 'R5754:Qdpr'
ID444943
Institutional Source Beutler Lab
Gene Symbol Qdpr
Ensembl Gene ENSMUSG00000015806
Gene Namequinoid dihydropteridine reductase
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R5754 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location45434021-45450236 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45439385 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 146 (G146S)
Ref Sequence ENSEMBL: ENSMUSP00000122081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015950] [ENSMUST00000117425] [ENSMUST00000118097] [ENSMUST00000120867] [ENSMUST00000127562] [ENSMUST00000154962] [ENSMUST00000197946] [ENSMUST00000198258]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015950
AA Change: G146S

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000015950
Gene: ENSMUSG00000015806
AA Change: G146S

DomainStartEndE-ValueType
Pfam:adh_short 8 195 5.4e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117425
AA Change: G94S

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112469
Gene: ENSMUSG00000015806
AA Change: G94S

DomainStartEndE-ValueType
PDB:1DIR|D 1 189 1e-124 PDB
SCOP:d1hdr__ 7 189 4e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118097
AA Change: G94S

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113958
Gene: ENSMUSG00000015806
AA Change: G94S

DomainStartEndE-ValueType
PDB:1DIR|D 1 189 1e-124 PDB
SCOP:d1hdr__ 7 189 4e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120867
AA Change: G94S

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113203
Gene: ENSMUSG00000015806
AA Change: G94S

DomainStartEndE-ValueType
PDB:1DIR|D 1 189 1e-124 PDB
SCOP:d1hdr__ 7 189 4e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127562
SMART Domains Protein: ENSMUSP00000115453
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 137 7e-67 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149290
Predicted Effect probably damaging
Transcript: ENSMUST00000154962
AA Change: G146S

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122081
Gene: ENSMUSG00000015806
AA Change: G146S

DomainStartEndE-ValueType
PDB:1DIR|D 1 159 7e-72 PDB
SCOP:d1hdr__ 6 159 6e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196216
Predicted Effect possibly damaging
Transcript: ENSMUST00000197946
AA Change: G146S

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143584
Gene: ENSMUSG00000015806
AA Change: G146S

DomainStartEndE-ValueType
PDB:1DIR|D 1 213 1e-125 PDB
SCOP:d1hdr__ 6 162 2e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000198258
AA Change: G44S

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143741
Gene: ENSMUSG00000015806
AA Change: G44S

DomainStartEndE-ValueType
PDB:1DIR|D 1 139 8e-86 PDB
SCOP:d1hdr__ 14 139 6e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200259
Meta Mutation Damage Score 0.0376 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme dihydropteridine reductase, which catalyzes the NADH-mediated reduction of quinonoid dihydrobiopterin. This enzyme is an essential component of the pterin-dependent aromatic amino acid hydroxylating systems. Mutations in this gene resulting in QDPR deficiency include aberrant splicing, amino acid substitutions, insertions, or premature terminations. Dihydropteridine reductase deficiency presents as atypical phenylketonuria due to insufficient production of biopterin, a cofactor for phenylalanine hydroxylase. [provided by RefSeq, Jul 2008]
PHENOTYPE: A portion of mice homozygous for a knock-out allele display abnormal rib-sternum attachment, a split xiphoid process, and lumbar vertebral transformation. Another knock-out allele exhibits abnormal folate and biopterin metabolism and oxidative stress in the liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,269,541 S609P probably damaging Het
Abcb4 T A 5: 8,934,320 N683K probably benign Het
Atad2b T A 12: 5,010,351 H915Q probably benign Het
Camk1d G T 2: 5,445,097 P91Q probably benign Het
Camk1d G C 2: 5,445,099 S90R probably damaging Het
Card11 T C 5: 140,899,769 E345G probably damaging Het
Ccdc58 A G 16: 36,085,057 N63S probably benign Het
Ccpg1 G T 9: 73,013,244 V714L possibly damaging Het
Chst9 T C 18: 15,453,197 E103G possibly damaging Het
Cnga1 C T 5: 72,605,272 V300I probably benign Het
Crb1 T C 1: 139,231,599 Y1295C probably damaging Het
Dnah5 A G 15: 28,401,868 T3392A probably benign Het
Elp3 C A 14: 65,547,990 R473L probably damaging Het
Epgn T A 5: 91,033,948 I145N probably benign Het
Fam107b G A 2: 3,778,420 G220D probably damaging Het
Fbn2 A G 18: 58,124,311 V328A probably benign Het
Fn1 A T 1: 71,600,322 I1770N probably damaging Het
Fndc1 T A 17: 7,769,753 Y1159F unknown Het
Frem2 A G 3: 53,537,258 L2484P probably damaging Het
Grk2 C T 19: 4,290,468 R295H probably damaging Het
Gtf3c1 A T 7: 125,644,065 V1789D possibly damaging Het
Hmgcl T C 4: 135,950,587 V33A probably damaging Het
Ighv7-1 A G 12: 113,896,619 F51S probably damaging Het
Kcna6 A G 6: 126,739,725 L67P probably damaging Het
Lamc1 A T 1: 153,247,284 V720E probably benign Het
Lrch1 T C 14: 74,817,118 D312G probably damaging Het
Nav2 A G 7: 49,557,046 T1540A probably damaging Het
Nisch A T 14: 31,191,416 probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Npc1l1 A G 11: 6,227,839 Y524H probably damaging Het
Nrap T C 19: 56,389,484 T25A possibly damaging Het
Nusap1 A G 2: 119,647,099 K363R probably damaging Het
Olfr1019 T C 2: 85,841,312 T160A probably damaging Het
Olfr1489 A G 19: 13,633,993 E294G probably damaging Het
Olfr873 T A 9: 20,301,094 L298Q probably damaging Het
Pde4d T C 13: 109,938,013 I384T probably damaging Het
Pkhd1 T A 1: 20,523,651 R1413* probably null Het
Plcd3 T A 11: 103,073,766 Y593F possibly damaging Het
Plxna1 A T 6: 89,333,105 I1026N possibly damaging Het
Podxl T A 6: 31,524,394 I409F probably damaging Het
Polq A C 16: 37,017,263 Q179P probably benign Het
Pomt1 T C 2: 32,247,590 V401A probably damaging Het
Shc4 T A 2: 125,670,298 Q2L probably damaging Het
Skint8 T A 4: 111,950,190 C358S probably benign Het
Smc5 T C 19: 23,244,103 E354G possibly damaging Het
Snx30 T C 4: 59,868,275 V129A probably damaging Het
Sp110 G C 1: 85,577,202 probably benign Het
Spag6 T A 2: 18,698,802 probably benign Het
Trim28 T A 7: 13,029,109 Y450N probably benign Het
Trip11 C T 12: 101,885,665 W428* probably null Het
Umodl1 T A 17: 30,994,787 V966E probably damaging Het
Utf1 A G 7: 139,944,791 probably benign Het
Vmn1r72 T C 7: 11,669,849 Y224C probably damaging Het
Whrn A G 4: 63,416,588 S748P probably damaging Het
Zbtb41 T A 1: 139,432,078 probably null Het
Zfhx3 T C 8: 108,800,332 F954L probably damaging Het
Zfp456 A T 13: 67,366,240 I449K probably benign Het
Other mutations in Qdpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Qdpr APN 5 45434676 missense possibly damaging 0.93
R0907:Qdpr UTSW 5 45439386 missense probably benign 0.16
R1387:Qdpr UTSW 5 45450138 start gained probably benign
R1964:Qdpr UTSW 5 45439318 missense possibly damaging 0.58
R2431:Qdpr UTSW 5 45444730 missense probably damaging 1.00
R4586:Qdpr UTSW 5 45439327 missense possibly damaging 0.60
R5678:Qdpr UTSW 5 45447637 missense possibly damaging 0.65
R7392:Qdpr UTSW 5 45439376 missense probably benign 0.37
X0022:Qdpr UTSW 5 45439355 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTCACACACTCAAAGCTCTG -3'
(R):5'- ACCTGCACTTTTGGAAACCG -3'

Sequencing Primer
(F):5'- TCTGATAGAAAGAGCCTCTCAAACTG -3'
(R):5'- ACTTTTGGAAACCGGCCAG -3'
Posted On2016-11-21