Incidental Mutation 'R5754:Cnga1'
ID444944
Institutional Source Beutler Lab
Gene Symbol Cnga1
Ensembl Gene ENSMUSG00000067220
Gene Namecyclic nucleotide gated channel alpha 1
SynonymsCncg
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R5754 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location72603696-72644275 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72605272 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 300 (V300I)
Ref Sequence ENSEMBL: ENSMUSP00000143881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087213] [ENSMUST00000169997] [ENSMUST00000201463]
Predicted Effect probably benign
Transcript: ENSMUST00000087213
AA Change: V300I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000084464
Gene: ENSMUSG00000067220
AA Change: V300I

DomainStartEndE-ValueType
coiled coil region 111 150 N/A INTRINSIC
Pfam:Ion_trans 156 400 3e-33 PFAM
cNMP 471 595 3.31e-25 SMART
PDB:3SWF|C 615 684 6e-31 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000169997
AA Change: V300I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132329
Gene: ENSMUSG00000067220
AA Change: V300I

DomainStartEndE-ValueType
coiled coil region 111 150 N/A INTRINSIC
Pfam:Ion_trans 194 388 4.7e-19 PFAM
cNMP 471 595 3.31e-25 SMART
PDB:3SWF|C 615 684 6e-31 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000201463
AA Change: V300I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143881
Gene: ENSMUSG00000067220
AA Change: V300I

DomainStartEndE-ValueType
coiled coil region 111 150 N/A INTRINSIC
Pfam:Ion_trans 156 400 3e-33 PFAM
cNMP 471 595 3.31e-25 SMART
PDB:3SWF|C 615 684 6e-31 PDB
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in phototransduction. Along with another protein, the encoded protein forms a cGMP-gated cation channel in the plasma membrane, allowing depolarization of rod photoreceptors. This represents the last step in the phototransduction pathway. Defects in this gene are a cause of retinitis pigmentosa autosomal recessive (ARRP) disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,269,541 S609P probably damaging Het
Abcb4 T A 5: 8,934,320 N683K probably benign Het
Atad2b T A 12: 5,010,351 H915Q probably benign Het
Camk1d G T 2: 5,445,097 P91Q probably benign Het
Camk1d G C 2: 5,445,099 S90R probably damaging Het
Card11 T C 5: 140,899,769 E345G probably damaging Het
Ccdc58 A G 16: 36,085,057 N63S probably benign Het
Ccpg1 G T 9: 73,013,244 V714L possibly damaging Het
Chst9 T C 18: 15,453,197 E103G possibly damaging Het
Crb1 T C 1: 139,231,599 Y1295C probably damaging Het
Dnah5 A G 15: 28,401,868 T3392A probably benign Het
Elp3 C A 14: 65,547,990 R473L probably damaging Het
Epgn T A 5: 91,033,948 I145N probably benign Het
Fam107b G A 2: 3,778,420 G220D probably damaging Het
Fbn2 A G 18: 58,124,311 V328A probably benign Het
Fn1 A T 1: 71,600,322 I1770N probably damaging Het
Fndc1 T A 17: 7,769,753 Y1159F unknown Het
Frem2 A G 3: 53,537,258 L2484P probably damaging Het
Grk2 C T 19: 4,290,468 R295H probably damaging Het
Gtf3c1 A T 7: 125,644,065 V1789D possibly damaging Het
Hmgcl T C 4: 135,950,587 V33A probably damaging Het
Ighv7-1 A G 12: 113,896,619 F51S probably damaging Het
Kcna6 A G 6: 126,739,725 L67P probably damaging Het
Lamc1 A T 1: 153,247,284 V720E probably benign Het
Lrch1 T C 14: 74,817,118 D312G probably damaging Het
Nav2 A G 7: 49,557,046 T1540A probably damaging Het
Nisch A T 14: 31,191,416 probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Npc1l1 A G 11: 6,227,839 Y524H probably damaging Het
Nrap T C 19: 56,389,484 T25A possibly damaging Het
Nusap1 A G 2: 119,647,099 K363R probably damaging Het
Olfr1019 T C 2: 85,841,312 T160A probably damaging Het
Olfr1489 A G 19: 13,633,993 E294G probably damaging Het
Olfr873 T A 9: 20,301,094 L298Q probably damaging Het
Pde4d T C 13: 109,938,013 I384T probably damaging Het
Pkhd1 T A 1: 20,523,651 R1413* probably null Het
Plcd3 T A 11: 103,073,766 Y593F possibly damaging Het
Plxna1 A T 6: 89,333,105 I1026N possibly damaging Het
Podxl T A 6: 31,524,394 I409F probably damaging Het
Polq A C 16: 37,017,263 Q179P probably benign Het
Pomt1 T C 2: 32,247,590 V401A probably damaging Het
Qdpr C T 5: 45,439,385 G146S probably damaging Het
Shc4 T A 2: 125,670,298 Q2L probably damaging Het
Skint8 T A 4: 111,950,190 C358S probably benign Het
Smc5 T C 19: 23,244,103 E354G possibly damaging Het
Snx30 T C 4: 59,868,275 V129A probably damaging Het
Sp110 G C 1: 85,577,202 probably benign Het
Spag6 T A 2: 18,698,802 probably benign Het
Trim28 T A 7: 13,029,109 Y450N probably benign Het
Trip11 C T 12: 101,885,665 W428* probably null Het
Umodl1 T A 17: 30,994,787 V966E probably damaging Het
Utf1 A G 7: 139,944,791 probably benign Het
Vmn1r72 T C 7: 11,669,849 Y224C probably damaging Het
Whrn A G 4: 63,416,588 S748P probably damaging Het
Zbtb41 T A 1: 139,432,078 probably null Het
Zfhx3 T C 8: 108,800,332 F954L probably damaging Het
Zfp456 A T 13: 67,366,240 I449K probably benign Het
Other mutations in Cnga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02332:Cnga1 APN 5 72604486 missense probably damaging 1.00
IGL02345:Cnga1 APN 5 72605272 missense probably benign 0.00
IGL02354:Cnga1 APN 5 72616718 splice site probably null
IGL02361:Cnga1 APN 5 72616718 splice site probably null
IGL03025:Cnga1 APN 5 72605413 missense probably benign
IGL03257:Cnga1 APN 5 72610862 missense probably damaging 1.00
IGL03046:Cnga1 UTSW 5 72604338 missense probably benign 0.01
R0238:Cnga1 UTSW 5 72605031 missense probably damaging 0.97
R0238:Cnga1 UTSW 5 72605031 missense probably damaging 0.97
R0352:Cnga1 UTSW 5 72604503 missense possibly damaging 0.95
R1292:Cnga1 UTSW 5 72604683 missense probably damaging 1.00
R1386:Cnga1 UTSW 5 72612183 nonsense probably null
R1903:Cnga1 UTSW 5 72616725 missense possibly damaging 0.94
R2096:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2097:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2101:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2276:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2279:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2507:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2508:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R3005:Cnga1 UTSW 5 72605107 missense probably damaging 1.00
R3779:Cnga1 UTSW 5 72604783 missense probably damaging 1.00
R4357:Cnga1 UTSW 5 72618252 missense probably damaging 1.00
R4399:Cnga1 UTSW 5 72604381 missense probably damaging 0.98
R4615:Cnga1 UTSW 5 72604774 missense probably damaging 1.00
R4946:Cnga1 UTSW 5 72604764 missense probably damaging 1.00
R5229:Cnga1 UTSW 5 72609500 missense probably damaging 1.00
R5474:Cnga1 UTSW 5 72605193 missense probably damaging 1.00
R5566:Cnga1 UTSW 5 72618250 missense probably damaging 0.98
R5899:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R5906:Cnga1 UTSW 5 72610858 missense probably benign 0.19
R5954:Cnga1 UTSW 5 72604878 missense probably damaging 0.99
R5997:Cnga1 UTSW 5 72604575 missense probably damaging 0.98
R6087:Cnga1 UTSW 5 72610812 missense probably damaging 1.00
R6365:Cnga1 UTSW 5 72604945 missense probably benign 0.00
R6391:Cnga1 UTSW 5 72612359 critical splice donor site probably null
R6525:Cnga1 UTSW 5 72618231 missense probably damaging 1.00
R7046:Cnga1 UTSW 5 72629353 intron probably benign
R7229:Cnga1 UTSW 5 72618249 missense probably benign
R7299:Cnga1 UTSW 5 72605432 missense probably benign 0.20
R7367:Cnga1 UTSW 5 72605358 missense possibly damaging 0.75
R7425:Cnga1 UTSW 5 72609525 missense probably benign 0.12
R7449:Cnga1 UTSW 5 72605304 missense probably benign 0.29
R7538:Cnga1 UTSW 5 72612380 missense probably benign 0.24
X0062:Cnga1 UTSW 5 72604485 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGGCGAAAATTAAAACTCC -3'
(R):5'- CAGTGATACCGACCGATCTG -3'

Sequencing Primer
(F):5'- TGTACTCAGAATCCAGCACGGG -3'
(R):5'- GACCGATCTGCTGTACATCAAGTTTG -3'
Posted On2016-11-21