Incidental Mutation 'R5754:Kcna6'
ID444949
Institutional Source Beutler Lab
Gene Symbol Kcna6
Ensembl Gene ENSMUSG00000038077
Gene Namepotassium voltage-gated channel, shaker-related, subfamily, member 6
SynonymsMK1.6, Kv1.6
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5754 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location126708329-126740674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126739725 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 67 (L67P)
Ref Sequence ENSEMBL: ENSMUSP00000139481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040751] [ENSMUST00000112242] [ENSMUST00000185333]
Predicted Effect probably damaging
Transcript: ENSMUST00000040751
AA Change: L67P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036872
Gene: ENSMUSG00000038077
AA Change: L67P

DomainStartEndE-ValueType
BTB 41 141 3.64e-9 SMART
transmembrane domain 175 197 N/A INTRINSIC
low complexity region 223 230 N/A INTRINSIC
low complexity region 240 257 N/A INTRINSIC
Pfam:Ion_trans 265 457 3.6e-36 PFAM
Pfam:Ion_trans_2 377 462 8.1e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112242
AA Change: L67P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107861
Gene: ENSMUSG00000038077
AA Change: L67P

DomainStartEndE-ValueType
BTB 41 141 3.64e-9 SMART
Pfam:Ion_trans 173 469 6.1e-52 PFAM
Pfam:Ion_trans_2 377 462 3.8e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128137
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181126
Predicted Effect probably damaging
Transcript: ENSMUST00000185333
AA Change: L67P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139481
Gene: ENSMUSG00000038077
AA Change: L67P

DomainStartEndE-ValueType
BTB 41 141 3.64e-9 SMART
transmembrane domain 175 197 N/A INTRINSIC
low complexity region 223 230 N/A INTRINSIC
low complexity region 240 257 N/A INTRINSIC
Pfam:Ion_trans 265 457 3.6e-36 PFAM
Pfam:Ion_trans_2 377 462 8.1e-14 PFAM
Meta Mutation Damage Score 0.628 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class. The coding region of this gene is intronless, and the gene is clustered with genes KCNA1 and KCNA5 on chromosome 12. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in an increased thermal nociceptive threshold and in females an increase in circulating triglyceride levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,269,541 S609P probably damaging Het
Abcb4 T A 5: 8,934,320 N683K probably benign Het
Atad2b T A 12: 5,010,351 H915Q probably benign Het
Camk1d G T 2: 5,445,097 P91Q probably benign Het
Camk1d G C 2: 5,445,099 S90R probably damaging Het
Card11 T C 5: 140,899,769 E345G probably damaging Het
Ccdc58 A G 16: 36,085,057 N63S probably benign Het
Ccpg1 G T 9: 73,013,244 V714L possibly damaging Het
Chst9 T C 18: 15,453,197 E103G possibly damaging Het
Cnga1 C T 5: 72,605,272 V300I probably benign Het
Crb1 T C 1: 139,231,599 Y1295C probably damaging Het
Dnah5 A G 15: 28,401,868 T3392A probably benign Het
Elp3 C A 14: 65,547,990 R473L probably damaging Het
Epgn T A 5: 91,033,948 I145N probably benign Het
Fam107b G A 2: 3,778,420 G220D probably damaging Het
Fbn2 A G 18: 58,124,311 V328A probably benign Het
Fn1 A T 1: 71,600,322 I1770N probably damaging Het
Fndc1 T A 17: 7,769,753 Y1159F unknown Het
Frem2 A G 3: 53,537,258 L2484P probably damaging Het
Grk2 C T 19: 4,290,468 R295H probably damaging Het
Gtf3c1 A T 7: 125,644,065 V1789D possibly damaging Het
Hmgcl T C 4: 135,950,587 V33A probably damaging Het
Ighv7-1 A G 12: 113,896,619 F51S probably damaging Het
Lamc1 A T 1: 153,247,284 V720E probably benign Het
Lrch1 T C 14: 74,817,118 D312G probably damaging Het
Nav2 A G 7: 49,557,046 T1540A probably damaging Het
Nisch A T 14: 31,191,416 probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Npc1l1 A G 11: 6,227,839 Y524H probably damaging Het
Nrap T C 19: 56,389,484 T25A possibly damaging Het
Nusap1 A G 2: 119,647,099 K363R probably damaging Het
Olfr1019 T C 2: 85,841,312 T160A probably damaging Het
Olfr1489 A G 19: 13,633,993 E294G probably damaging Het
Olfr873 T A 9: 20,301,094 L298Q probably damaging Het
Pde4d T C 13: 109,938,013 I384T probably damaging Het
Pkhd1 T A 1: 20,523,651 R1413* probably null Het
Plcd3 T A 11: 103,073,766 Y593F possibly damaging Het
Plxna1 A T 6: 89,333,105 I1026N possibly damaging Het
Podxl T A 6: 31,524,394 I409F probably damaging Het
Polq A C 16: 37,017,263 Q179P probably benign Het
Pomt1 T C 2: 32,247,590 V401A probably damaging Het
Qdpr C T 5: 45,439,385 G146S probably damaging Het
Shc4 T A 2: 125,670,298 Q2L probably damaging Het
Skint8 T A 4: 111,950,190 C358S probably benign Het
Smc5 T C 19: 23,244,103 E354G possibly damaging Het
Snx30 T C 4: 59,868,275 V129A probably damaging Het
Sp110 G C 1: 85,577,202 probably benign Het
Spag6 T A 2: 18,698,802 probably benign Het
Trim28 T A 7: 13,029,109 Y450N probably benign Het
Trip11 C T 12: 101,885,665 W428* probably null Het
Umodl1 T A 17: 30,994,787 V966E probably damaging Het
Utf1 A G 7: 139,944,791 probably benign Het
Vmn1r72 T C 7: 11,669,849 Y224C probably damaging Het
Whrn A G 4: 63,416,588 S748P probably damaging Het
Zbtb41 T A 1: 139,432,078 probably null Het
Zfhx3 T C 8: 108,800,332 F954L probably damaging Het
Zfp456 A T 13: 67,366,240 I449K probably benign Het
Other mutations in Kcna6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Kcna6 APN 6 126738613 missense probably damaging 1.00
IGL01623:Kcna6 APN 6 126738613 missense probably damaging 1.00
IGL02385:Kcna6 APN 6 126738954 missense probably benign
IGL02452:Kcna6 APN 6 126738480 missense possibly damaging 0.57
IGL02480:Kcna6 APN 6 126738568 missense probably damaging 1.00
IGL02604:Kcna6 APN 6 126739204 missense probably benign 0.17
IGL02794:Kcna6 APN 6 126738552 missense probably damaging 1.00
R1599:Kcna6 UTSW 6 126739319 missense probably benign 0.00
R1932:Kcna6 UTSW 6 126738488 missense probably benign 0.16
R1984:Kcna6 UTSW 6 126738510 missense probably benign 0.34
R1985:Kcna6 UTSW 6 126738510 missense probably benign 0.34
R2114:Kcna6 UTSW 6 126739359 missense possibly damaging 0.93
R4111:Kcna6 UTSW 6 126739774 missense probably damaging 1.00
R4112:Kcna6 UTSW 6 126739774 missense probably damaging 1.00
R4793:Kcna6 UTSW 6 126738556 missense probably damaging 1.00
R4818:Kcna6 UTSW 6 126738424 missense probably benign 0.00
R4884:Kcna6 UTSW 6 126738726 missense probably benign 0.08
R5126:Kcna6 UTSW 6 126738732 missense probably damaging 1.00
R6074:Kcna6 UTSW 6 126739279 missense probably benign
R7332:Kcna6 UTSW 6 126739329 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGAGTGGTTTCTCATCCTCG -3'
(R):5'- GAGATCGGAGAAATCCCTGACG -3'

Sequencing Primer
(F):5'- GGCTTCCTCTCCCAACTGATAGAAG -3'
(R):5'- AGAAATCCCTGACGCTGGC -3'
Posted On2016-11-21