Incidental Mutation 'R5754:Atad2b'
ID444961
Institutional Source Beutler Lab
Gene Symbol Atad2b
Ensembl Gene ENSMUSG00000052812
Gene NameATPase family, AAA domain containing 2B
SynonymsD530031C13Rik, 1110014E10Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5754 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location4917353-5047394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5010351 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 915 (H915Q)
Ref Sequence ENSEMBL: ENSMUSP00000047445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045664] [ENSMUST00000218859]
Predicted Effect probably benign
Transcript: ENSMUST00000045664
AA Change: H915Q

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000047445
Gene: ENSMUSG00000052812
AA Change: H915Q

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 252 278 N/A INTRINSIC
AAA 432 573 4.56e-20 SMART
SCOP:d1e32a2 771 912 3e-4 SMART
BROMO 958 1070 4.24e-20 SMART
low complexity region 1135 1144 N/A INTRINSIC
low complexity region 1230 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218859
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced body size and fertility in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,269,541 S609P probably damaging Het
Abcb4 T A 5: 8,934,320 N683K probably benign Het
Camk1d G T 2: 5,445,097 P91Q probably benign Het
Camk1d G C 2: 5,445,099 S90R probably damaging Het
Card11 T C 5: 140,899,769 E345G probably damaging Het
Ccdc58 A G 16: 36,085,057 N63S probably benign Het
Ccpg1 G T 9: 73,013,244 V714L possibly damaging Het
Chst9 T C 18: 15,453,197 E103G possibly damaging Het
Cnga1 C T 5: 72,605,272 V300I probably benign Het
Crb1 T C 1: 139,231,599 Y1295C probably damaging Het
Dnah5 A G 15: 28,401,868 T3392A probably benign Het
Elp3 C A 14: 65,547,990 R473L probably damaging Het
Epgn T A 5: 91,033,948 I145N probably benign Het
Fam107b G A 2: 3,778,420 G220D probably damaging Het
Fbn2 A G 18: 58,124,311 V328A probably benign Het
Fn1 A T 1: 71,600,322 I1770N probably damaging Het
Fndc1 T A 17: 7,769,753 Y1159F unknown Het
Frem2 A G 3: 53,537,258 L2484P probably damaging Het
Grk2 C T 19: 4,290,468 R295H probably damaging Het
Gtf3c1 A T 7: 125,644,065 V1789D possibly damaging Het
Hmgcl T C 4: 135,950,587 V33A probably damaging Het
Ighv7-1 A G 12: 113,896,619 F51S probably damaging Het
Kcna6 A G 6: 126,739,725 L67P probably damaging Het
Lamc1 A T 1: 153,247,284 V720E probably benign Het
Lrch1 T C 14: 74,817,118 D312G probably damaging Het
Nav2 A G 7: 49,557,046 T1540A probably damaging Het
Nisch A T 14: 31,191,416 probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Npc1l1 A G 11: 6,227,839 Y524H probably damaging Het
Nrap T C 19: 56,389,484 T25A possibly damaging Het
Nusap1 A G 2: 119,647,099 K363R probably damaging Het
Olfr1019 T C 2: 85,841,312 T160A probably damaging Het
Olfr1489 A G 19: 13,633,993 E294G probably damaging Het
Olfr873 T A 9: 20,301,094 L298Q probably damaging Het
Pde4d T C 13: 109,938,013 I384T probably damaging Het
Pkhd1 T A 1: 20,523,651 R1413* probably null Het
Plcd3 T A 11: 103,073,766 Y593F possibly damaging Het
Plxna1 A T 6: 89,333,105 I1026N possibly damaging Het
Podxl T A 6: 31,524,394 I409F probably damaging Het
Polq A C 16: 37,017,263 Q179P probably benign Het
Pomt1 T C 2: 32,247,590 V401A probably damaging Het
Qdpr C T 5: 45,439,385 G146S probably damaging Het
Shc4 T A 2: 125,670,298 Q2L probably damaging Het
Skint8 T A 4: 111,950,190 C358S probably benign Het
Smc5 T C 19: 23,244,103 E354G possibly damaging Het
Snx30 T C 4: 59,868,275 V129A probably damaging Het
Sp110 G C 1: 85,577,202 probably benign Het
Spag6 T A 2: 18,698,802 probably benign Het
Trim28 T A 7: 13,029,109 Y450N probably benign Het
Trip11 C T 12: 101,885,665 W428* probably null Het
Umodl1 T A 17: 30,994,787 V966E probably damaging Het
Utf1 A G 7: 139,944,791 probably benign Het
Vmn1r72 T C 7: 11,669,849 Y224C probably damaging Het
Whrn A G 4: 63,416,588 S748P probably damaging Het
Zbtb41 T A 1: 139,432,078 probably null Het
Zfhx3 T C 8: 108,800,332 F954L probably damaging Het
Zfp456 A T 13: 67,366,240 I449K probably benign Het
Other mutations in Atad2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Atad2b APN 12 5024593 missense probably damaging 1.00
IGL00917:Atad2b APN 12 4965837 unclassified probably benign
IGL01011:Atad2b APN 12 4965984 missense probably benign 0.01
IGL01092:Atad2b APN 12 5017987 missense probably damaging 0.98
IGL01604:Atad2b APN 12 4965837 unclassified probably benign
IGL01924:Atad2b APN 12 5034093 missense probably damaging 1.00
IGL02197:Atad2b APN 12 5018056 missense possibly damaging 0.84
IGL02397:Atad2b APN 12 4974046 missense probably damaging 1.00
IGL02404:Atad2b APN 12 4941972 missense probably benign 0.08
IGL02517:Atad2b APN 12 5018037 missense probably benign 0.07
IGL02726:Atad2b APN 12 4974003 nonsense probably null
IGL02896:Atad2b APN 12 4958151 missense probably damaging 1.00
IGL03227:Atad2b APN 12 5006715 missense probably damaging 1.00
IGL03265:Atad2b APN 12 5024628 missense probably benign 0.24
K3955:Atad2b UTSW 12 4954536 splice site probably benign
P0038:Atad2b UTSW 12 4954536 splice site probably benign
PIT4418001:Atad2b UTSW 12 5024587 missense probably benign 0.07
PIT4431001:Atad2b UTSW 12 5031795 missense possibly damaging 0.77
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0124:Atad2b UTSW 12 4952676 missense probably benign 0.23
R0462:Atad2b UTSW 12 4941973 missense possibly damaging 0.79
R0483:Atad2b UTSW 12 4945035 splice site probably benign
R0617:Atad2b UTSW 12 4937401 missense probably benign 0.43
R0894:Atad2b UTSW 12 4965915 missense probably damaging 1.00
R0942:Atad2b UTSW 12 5024591 missense probably damaging 1.00
R0960:Atad2b UTSW 12 5006593 splice site probably benign
R0973:Atad2b UTSW 12 5031784 missense probably benign 0.00
R1306:Atad2b UTSW 12 4974239 missense probably benign 0.08
R1530:Atad2b UTSW 12 4942018 nonsense probably null
R1678:Atad2b UTSW 12 4965899 missense possibly damaging 0.91
R1689:Atad2b UTSW 12 5034575 nonsense probably null
R1826:Atad2b UTSW 12 4974094 missense probably benign 0.00
R1996:Atad2b UTSW 12 4990883 missense probably benign 0.01
R2233:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2235:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2943:Atad2b UTSW 12 4942067 missense probably damaging 0.98
R3161:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3508:Atad2b UTSW 12 4950595 critical splice donor site probably null
R4239:Atad2b UTSW 12 4985710 missense probably benign 0.05
R4401:Atad2b UTSW 12 4940145 missense probably damaging 0.99
R4558:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4559:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4573:Atad2b UTSW 12 4954663 splice site probably null
R4639:Atad2b UTSW 12 5018053 missense probably damaging 1.00
R4847:Atad2b UTSW 12 4944901 splice site probably null
R4850:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4851:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4979:Atad2b UTSW 12 5034513 missense probably damaging 1.00
R5024:Atad2b UTSW 12 4937534 missense probably benign 0.45
R5305:Atad2b UTSW 12 4965855 missense probably damaging 1.00
R5405:Atad2b UTSW 12 4940098 missense possibly damaging 0.87
R5627:Atad2b UTSW 12 4917911 missense probably benign 0.01
R6163:Atad2b UTSW 12 4954593 missense probably benign 0.00
R6371:Atad2b UTSW 12 4973970 missense probably damaging 1.00
R6374:Atad2b UTSW 12 5018002 missense probably damaging 1.00
R6399:Atad2b UTSW 12 4957558 missense probably damaging 1.00
R6433:Atad2b UTSW 12 4952642 missense possibly damaging 0.89
R6546:Atad2b UTSW 12 4990949 missense probably damaging 1.00
R6617:Atad2b UTSW 12 5024668 missense probably benign 0.00
R7199:Atad2b UTSW 12 5017992 missense probably damaging 1.00
R7267:Atad2b UTSW 12 5027105 nonsense probably null
R7405:Atad2b UTSW 12 4943232 missense probably benign 0.08
R7460:Atad2b UTSW 12 4952660 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CTGTGCTTATTGAGAATGGGAC -3'
(R):5'- CCTTGGATTAGGTACACACAGCC -3'

Sequencing Primer
(F):5'- AAGTACACTGTAGCTGTCGC -3'
(R):5'- GGATTAGGTACACACAGCCATTTTC -3'
Posted On2016-11-21