Incidental Mutation 'R5754:Fndc1'
ID444973
Institutional Source Beutler Lab
Gene Symbol Fndc1
Ensembl Gene ENSMUSG00000071984
Gene Namefibronectin type III domain containing 1
Synonyms1110027O12Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5754 (G1)
Quality Score176
Status Validated
Chromosome17
Chromosomal Location7738569-7827302 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7769753 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1159 (Y1159F)
Ref Sequence ENSEMBL: ENSMUSP00000095036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097425]
Predicted Effect unknown
Transcript: ENSMUST00000097425
AA Change: Y1159F
SMART Domains Protein: ENSMUSP00000095036
Gene: ENSMUSG00000071984
AA Change: Y1159F

DomainStartEndE-ValueType
Blast:FN3 1 50 6e-25 BLAST
FN3 54 137 7.82e-4 SMART
FN3 156 240 1.48e-4 SMART
FN3 256 340 3.67e-9 SMART
low complexity region 377 388 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 646 676 N/A INTRINSIC
low complexity region 766 777 N/A INTRINSIC
low complexity region 868 884 N/A INTRINSIC
low complexity region 1021 1027 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1076 1090 N/A INTRINSIC
Blast:FN3 1227 1276 2e-18 BLAST
low complexity region 1277 1354 N/A INTRINSIC
low complexity region 1395 1403 N/A INTRINSIC
low complexity region 1407 1423 N/A INTRINSIC
FN3 1494 1577 4.32e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114579
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,269,541 S609P probably damaging Het
Abcb4 T A 5: 8,934,320 N683K probably benign Het
Atad2b T A 12: 5,010,351 H915Q probably benign Het
Camk1d G T 2: 5,445,097 P91Q probably benign Het
Camk1d G C 2: 5,445,099 S90R probably damaging Het
Card11 T C 5: 140,899,769 E345G probably damaging Het
Ccdc58 A G 16: 36,085,057 N63S probably benign Het
Ccpg1 G T 9: 73,013,244 V714L possibly damaging Het
Chst9 T C 18: 15,453,197 E103G possibly damaging Het
Cnga1 C T 5: 72,605,272 V300I probably benign Het
Crb1 T C 1: 139,231,599 Y1295C probably damaging Het
Dnah5 A G 15: 28,401,868 T3392A probably benign Het
Elp3 C A 14: 65,547,990 R473L probably damaging Het
Epgn T A 5: 91,033,948 I145N probably benign Het
Fam107b G A 2: 3,778,420 G220D probably damaging Het
Fbn2 A G 18: 58,124,311 V328A probably benign Het
Fn1 A T 1: 71,600,322 I1770N probably damaging Het
Frem2 A G 3: 53,537,258 L2484P probably damaging Het
Grk2 C T 19: 4,290,468 R295H probably damaging Het
Gtf3c1 A T 7: 125,644,065 V1789D possibly damaging Het
Hmgcl T C 4: 135,950,587 V33A probably damaging Het
Ighv7-1 A G 12: 113,896,619 F51S probably damaging Het
Kcna6 A G 6: 126,739,725 L67P probably damaging Het
Lamc1 A T 1: 153,247,284 V720E probably benign Het
Lrch1 T C 14: 74,817,118 D312G probably damaging Het
Nav2 A G 7: 49,557,046 T1540A probably damaging Het
Nisch A T 14: 31,191,416 probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Npc1l1 A G 11: 6,227,839 Y524H probably damaging Het
Nrap T C 19: 56,389,484 T25A possibly damaging Het
Nusap1 A G 2: 119,647,099 K363R probably damaging Het
Olfr1019 T C 2: 85,841,312 T160A probably damaging Het
Olfr1489 A G 19: 13,633,993 E294G probably damaging Het
Olfr873 T A 9: 20,301,094 L298Q probably damaging Het
Pde4d T C 13: 109,938,013 I384T probably damaging Het
Pkhd1 T A 1: 20,523,651 R1413* probably null Het
Plcd3 T A 11: 103,073,766 Y593F possibly damaging Het
Plxna1 A T 6: 89,333,105 I1026N possibly damaging Het
Podxl T A 6: 31,524,394 I409F probably damaging Het
Polq A C 16: 37,017,263 Q179P probably benign Het
Pomt1 T C 2: 32,247,590 V401A probably damaging Het
Qdpr C T 5: 45,439,385 G146S probably damaging Het
Shc4 T A 2: 125,670,298 Q2L probably damaging Het
Skint8 T A 4: 111,950,190 C358S probably benign Het
Smc5 T C 19: 23,244,103 E354G possibly damaging Het
Snx30 T C 4: 59,868,275 V129A probably damaging Het
Sp110 G C 1: 85,577,202 probably benign Het
Spag6 T A 2: 18,698,802 probably benign Het
Trim28 T A 7: 13,029,109 Y450N probably benign Het
Trip11 C T 12: 101,885,665 W428* probably null Het
Umodl1 T A 17: 30,994,787 V966E probably damaging Het
Utf1 A G 7: 139,944,791 probably benign Het
Vmn1r72 T C 7: 11,669,849 Y224C probably damaging Het
Whrn A G 4: 63,416,588 S748P probably damaging Het
Zbtb41 T A 1: 139,432,078 probably null Het
Zfhx3 T C 8: 108,800,332 F954L probably damaging Het
Zfp456 A T 13: 67,366,240 I449K probably benign Het
Other mutations in Fndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Fndc1 APN 17 7765254 missense unknown
IGL00590:Fndc1 APN 17 7765101 missense unknown
IGL00765:Fndc1 APN 17 7772693 missense unknown
IGL00904:Fndc1 APN 17 7756363 missense probably benign 0.35
IGL01153:Fndc1 APN 17 7780042 critical splice donor site probably null
IGL01557:Fndc1 APN 17 7756389 missense probably damaging 0.99
IGL02493:Fndc1 APN 17 7775545 missense unknown
IGL02501:Fndc1 APN 17 7765398 missense unknown
IGL02503:Fndc1 APN 17 7771516 missense unknown
IGL02887:Fndc1 APN 17 7773638 missense unknown
IGL03348:Fndc1 APN 17 7772647 missense unknown
pinnacle UTSW 17 7773322 missense unknown
spire UTSW 17 7771480 missense unknown
IGL02988:Fndc1 UTSW 17 7753523 missense possibly damaging 0.95
PIT4466001:Fndc1 UTSW 17 7750374 missense probably damaging 1.00
R0336:Fndc1 UTSW 17 7765107 missense unknown
R0403:Fndc1 UTSW 17 7753723 missense probably damaging 1.00
R0403:Fndc1 UTSW 17 7775588 intron probably null
R0538:Fndc1 UTSW 17 7784341 splice site probably benign
R0646:Fndc1 UTSW 17 7741673 missense possibly damaging 0.92
R1140:Fndc1 UTSW 17 7775426 missense unknown
R1523:Fndc1 UTSW 17 7773209 missense unknown
R1609:Fndc1 UTSW 17 7772766 missense unknown
R1632:Fndc1 UTSW 17 7773200 missense unknown
R1888:Fndc1 UTSW 17 7771789 missense unknown
R1888:Fndc1 UTSW 17 7771789 missense unknown
R2004:Fndc1 UTSW 17 7804929 missense probably damaging 1.00
R2007:Fndc1 UTSW 17 7778748 unclassified probably benign
R2128:Fndc1 UTSW 17 7778665 unclassified probably benign
R2187:Fndc1 UTSW 17 7741772 missense probably damaging 1.00
R2251:Fndc1 UTSW 17 7753607 missense probably damaging 1.00
R2322:Fndc1 UTSW 17 7789015 missense probably damaging 0.98
R2425:Fndc1 UTSW 17 7805018 missense probably damaging 1.00
R2921:Fndc1 UTSW 17 7804875 missense probably damaging 0.98
R2985:Fndc1 UTSW 17 7756323 missense possibly damaging 0.93
R3436:Fndc1 UTSW 17 7750357 missense probably damaging 0.99
R3499:Fndc1 UTSW 17 7753584 missense possibly damaging 0.70
R3508:Fndc1 UTSW 17 7765108 nonsense probably null
R3766:Fndc1 UTSW 17 7784421 missense probably damaging 1.00
R3813:Fndc1 UTSW 17 7773322 missense unknown
R3814:Fndc1 UTSW 17 7773322 missense unknown
R4031:Fndc1 UTSW 17 7769752 nonsense probably null
R4544:Fndc1 UTSW 17 7773544 missense unknown
R4583:Fndc1 UTSW 17 7739249 missense probably damaging 1.00
R4619:Fndc1 UTSW 17 7765204 missense unknown
R4700:Fndc1 UTSW 17 7771480 missense unknown
R4743:Fndc1 UTSW 17 7772279 nonsense probably null
R4803:Fndc1 UTSW 17 7753706 missense probably damaging 0.98
R4862:Fndc1 UTSW 17 7769735 missense unknown
R4876:Fndc1 UTSW 17 7771639 missense unknown
R5057:Fndc1 UTSW 17 7771970 nonsense probably null
R5327:Fndc1 UTSW 17 7772708 missense unknown
R5372:Fndc1 UTSW 17 7765210 missense unknown
R5533:Fndc1 UTSW 17 7772776 missense unknown
R5762:Fndc1 UTSW 17 7771534 missense unknown
R5830:Fndc1 UTSW 17 7789086 missense possibly damaging 0.87
R5924:Fndc1 UTSW 17 7773610 missense unknown
R6147:Fndc1 UTSW 17 7753762 splice site probably null
R6175:Fndc1 UTSW 17 7772647 missense unknown
R6303:Fndc1 UTSW 17 7758485 missense probably damaging 0.98
R6377:Fndc1 UTSW 17 7769735 missense unknown
R6704:Fndc1 UTSW 17 7771810 missense unknown
R6857:Fndc1 UTSW 17 7772170 missense unknown
R6865:Fndc1 UTSW 17 7772840 missense unknown
R7069:Fndc1 UTSW 17 7769735 missense unknown
R7153:Fndc1 UTSW 17 7801645 missense probably damaging 1.00
R7159:Fndc1 UTSW 17 7800931 missense probably damaging 0.97
Z1088:Fndc1 UTSW 17 7782479 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTTGGCACACAGTATCCACG -3'
(R):5'- CTCAGCACTGTCAGACTGTCAC -3'

Sequencing Primer
(F):5'- GGCACACAGTATCCACGGTTTTTC -3'
(R):5'- ACTGTCAGACTGTCACGTGAC -3'
Posted On2016-11-21