Incidental Mutation 'R5754:Grk2'
ID444977
Institutional Source Beutler Lab
Gene Symbol Grk2
Ensembl Gene ENSMUSG00000024858
Gene NameG protein-coupled receptor kinase 2
SynonymsAdrbk-1, beta-adrenergic receptor kinase-1, beta-AR kinase-1, Bark-1, beta ARK, beta ARK1, betaARK1, Adrbk1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5754 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4286001-4306222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4290468 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 295 (R295H)
Ref Sequence ENSEMBL: ENSMUSP00000086114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025791] [ENSMUST00000088737] [ENSMUST00000113837] [ENSMUST00000167511] [ENSMUST00000171123]
Predicted Effect probably damaging
Transcript: ENSMUST00000025791
AA Change: R253H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000025791
Gene: ENSMUSG00000024858
AA Change: R253H

DomainStartEndE-ValueType
RGS 12 133 3.17e-30 SMART
S_TKc 149 411 2.43e-86 SMART
S_TK_X 412 491 5.3e-9 SMART
PH 517 612 2.79e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000088737
AA Change: R295H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086114
Gene: ENSMUSG00000024858
AA Change: R295H

DomainStartEndE-ValueType
RGS 54 175 3.17e-30 SMART
S_TKc 191 453 2.43e-86 SMART
S_TK_X 454 533 5.3e-9 SMART
PH 559 654 2.79e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113837
SMART Domains Protein: ENSMUSP00000109468
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
RGS 54 175 3.17e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164427
Predicted Effect unknown
Transcript: ENSMUST00000165954
AA Change: R5H
SMART Domains Protein: ENSMUSP00000128177
Gene: ENSMUSG00000024858
AA Change: R5H

DomainStartEndE-ValueType
Pfam:Pkinase 1 169 5.8e-46 PFAM
Pfam:Pkinase_Tyr 2 155 9.3e-20 PFAM
S_TK_X 170 208 3.39e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167172
Predicted Effect probably benign
Transcript: ENSMUST00000167511
SMART Domains Protein: ENSMUSP00000129839
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
Pfam:RGS 74 134 4.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168594
SMART Domains Protein: ENSMUSP00000126025
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
Blast:S_TKc 2 38 2e-18 BLAST
S_TK_X 39 85 2.95e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169991
Predicted Effect probably damaging
Transcript: ENSMUST00000171123
AA Change: R295H

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126930
Gene: ENSMUSG00000024858
AA Change: R295H

DomainStartEndE-ValueType
RGS 54 175 3.17e-30 SMART
Pfam:Pkinase_Tyr 191 378 1.1e-21 PFAM
Pfam:Pkinase 191 381 4.9e-50 PFAM
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene phosphorylates the beta-2-adrenergic receptor and appears to mediate agonist-specific desensitization observed at high agonist concentrations. This protein is an ubiquitous cytosolic enzyme that specifically phosphorylates the activated form of the beta-adrenergic and related G-protein-coupled receptors. Abnormal coupling of beta-adrenergic receptor to G protein is involved in the pathogenesis of the failing heart. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality likely due to heart failure. Homozygous mutant embryos are pale in appearance and exhibit ventricular hypoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,269,541 S609P probably damaging Het
Abcb4 T A 5: 8,934,320 N683K probably benign Het
Atad2b T A 12: 5,010,351 H915Q probably benign Het
Camk1d G T 2: 5,445,097 P91Q probably benign Het
Camk1d G C 2: 5,445,099 S90R probably damaging Het
Card11 T C 5: 140,899,769 E345G probably damaging Het
Ccdc58 A G 16: 36,085,057 N63S probably benign Het
Ccpg1 G T 9: 73,013,244 V714L possibly damaging Het
Chst9 T C 18: 15,453,197 E103G possibly damaging Het
Cnga1 C T 5: 72,605,272 V300I probably benign Het
Crb1 T C 1: 139,231,599 Y1295C probably damaging Het
Dnah5 A G 15: 28,401,868 T3392A probably benign Het
Elp3 C A 14: 65,547,990 R473L probably damaging Het
Epgn T A 5: 91,033,948 I145N probably benign Het
Fam107b G A 2: 3,778,420 G220D probably damaging Het
Fbn2 A G 18: 58,124,311 V328A probably benign Het
Fn1 A T 1: 71,600,322 I1770N probably damaging Het
Fndc1 T A 17: 7,769,753 Y1159F unknown Het
Frem2 A G 3: 53,537,258 L2484P probably damaging Het
Gtf3c1 A T 7: 125,644,065 V1789D possibly damaging Het
Hmgcl T C 4: 135,950,587 V33A probably damaging Het
Ighv7-1 A G 12: 113,896,619 F51S probably damaging Het
Kcna6 A G 6: 126,739,725 L67P probably damaging Het
Lamc1 A T 1: 153,247,284 V720E probably benign Het
Lrch1 T C 14: 74,817,118 D312G probably damaging Het
Nav2 A G 7: 49,557,046 T1540A probably damaging Het
Nisch A T 14: 31,191,416 probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Npc1l1 A G 11: 6,227,839 Y524H probably damaging Het
Nrap T C 19: 56,389,484 T25A possibly damaging Het
Nusap1 A G 2: 119,647,099 K363R probably damaging Het
Olfr1019 T C 2: 85,841,312 T160A probably damaging Het
Olfr1489 A G 19: 13,633,993 E294G probably damaging Het
Olfr873 T A 9: 20,301,094 L298Q probably damaging Het
Pde4d T C 13: 109,938,013 I384T probably damaging Het
Pkhd1 T A 1: 20,523,651 R1413* probably null Het
Plcd3 T A 11: 103,073,766 Y593F possibly damaging Het
Plxna1 A T 6: 89,333,105 I1026N possibly damaging Het
Podxl T A 6: 31,524,394 I409F probably damaging Het
Polq A C 16: 37,017,263 Q179P probably benign Het
Pomt1 T C 2: 32,247,590 V401A probably damaging Het
Qdpr C T 5: 45,439,385 G146S probably damaging Het
Shc4 T A 2: 125,670,298 Q2L probably damaging Het
Skint8 T A 4: 111,950,190 C358S probably benign Het
Smc5 T C 19: 23,244,103 E354G possibly damaging Het
Snx30 T C 4: 59,868,275 V129A probably damaging Het
Sp110 G C 1: 85,577,202 probably benign Het
Spag6 T A 2: 18,698,802 probably benign Het
Trim28 T A 7: 13,029,109 Y450N probably benign Het
Trip11 C T 12: 101,885,665 W428* probably null Het
Umodl1 T A 17: 30,994,787 V966E probably damaging Het
Utf1 A G 7: 139,944,791 probably benign Het
Vmn1r72 T C 7: 11,669,849 Y224C probably damaging Het
Whrn A G 4: 63,416,588 S748P probably damaging Het
Zbtb41 T A 1: 139,432,078 probably null Het
Zfhx3 T C 8: 108,800,332 F954L probably damaging Het
Zfp456 A T 13: 67,366,240 I449K probably benign Het
Other mutations in Grk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Grk2 APN 19 4289311 critical splice donor site probably null
IGL00927:Grk2 APN 19 4287954 missense probably benign 0.09
IGL01465:Grk2 APN 19 4290858 missense probably damaging 1.00
IGL02692:Grk2 APN 19 4290688 splice site probably benign
IGL02870:Grk2 APN 19 4290402 missense probably damaging 1.00
IGL03210:Grk2 APN 19 4287829 missense probably benign 0.01
IGL03227:Grk2 APN 19 4287829 missense probably benign 0.01
IGL03230:Grk2 APN 19 4287829 missense probably benign 0.01
PIT4480001:Grk2 UTSW 19 4287409 missense possibly damaging 0.93
R0008:Grk2 UTSW 19 4287234 missense probably damaging 0.99
R0371:Grk2 UTSW 19 4291586 splice site probably null
R0426:Grk2 UTSW 19 4290600 unclassified probably null
R0494:Grk2 UTSW 19 4291319 missense probably damaging 1.00
R0833:Grk2 UTSW 19 4289357 missense probably damaging 1.00
R1240:Grk2 UTSW 19 4290679 missense probably damaging 1.00
R1446:Grk2 UTSW 19 4287409 missense possibly damaging 0.93
R1499:Grk2 UTSW 19 4287194 missense probably benign 0.11
R1664:Grk2 UTSW 19 4287240 missense possibly damaging 0.48
R1796:Grk2 UTSW 19 4287940 missense probably benign 0.12
R1803:Grk2 UTSW 19 4294883 missense probably damaging 1.00
R2021:Grk2 UTSW 19 4290670 missense probably damaging 1.00
R3947:Grk2 UTSW 19 4292417 missense possibly damaging 0.95
R4551:Grk2 UTSW 19 4286056 missense possibly damaging 0.96
R4945:Grk2 UTSW 19 4290447 missense probably damaging 1.00
R5299:Grk2 UTSW 19 4292771 missense probably damaging 1.00
R5753:Grk2 UTSW 19 4290468 missense probably damaging 1.00
R5973:Grk2 UTSW 19 4287897 missense possibly damaging 0.88
R6026:Grk2 UTSW 19 4290783 missense probably damaging 0.99
R7117:Grk2 UTSW 19 4290602 critical splice donor site probably null
R7468:Grk2 UTSW 19 4306035 start gained probably benign
X0009:Grk2 UTSW 19 4291589 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGGAACTACATGGTTTTGGGAC -3'
(R):5'- ACAAGCTCAGCTTCATCCTG -3'

Sequencing Primer
(F):5'- ACAAGGCCCCAGGTAGG -3'
(R):5'- TCATCCTGGACCTCATGAACGG -3'
Posted On2016-11-21