Incidental Mutation 'R0027:Anapc1'
ID 44498
Institutional Source Beutler Lab
Gene Symbol Anapc1
Ensembl Gene ENSMUSG00000014355
Gene Name anaphase promoting complex subunit 1
Synonyms Apc1, tsg24, Mcpr, 2610021O03Rik
MMRRC Submission 038322-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0027 (G1) of strain 730
Quality Score 201
Status Validated (trace)
Chromosome 2
Chromosomal Location 128452024-128529311 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 128483431 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1221 (D1221E)
Ref Sequence ENSEMBL: ENSMUSP00000014499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014499] [ENSMUST00000110333]
AlphaFold P53995
Predicted Effect possibly damaging
Transcript: ENSMUST00000014499
AA Change: D1221E

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: D1221E

DomainStartEndE-ValueType
Pfam:ANAPC1 150 214 1.7e-13 PFAM
low complexity region 323 345 N/A INTRINSIC
low complexity region 1404 1415 N/A INTRINSIC
Pfam:PC_rep 1467 1501 8.3e-8 PFAM
low complexity region 1516 1528 N/A INTRINSIC
low complexity region 1924 1936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110333
SMART Domains Protein: ENSMUSP00000105962
Gene: ENSMUSG00000014355

DomainStartEndE-ValueType
Pfam:Apc1 149 227 1.7e-22 PFAM
low complexity region 323 345 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A T 15: 11,285,959 (GRCm39) I723F probably damaging Het
Arhgef28 T A 13: 98,082,204 (GRCm39) E1201V possibly damaging Het
Capn12 T A 7: 28,581,385 (GRCm39) H79Q probably benign Het
Caprin1 A T 2: 103,605,925 (GRCm39) probably benign Het
Carmil3 T A 14: 55,731,860 (GRCm39) F196Y probably damaging Het
Casp8ap2 A G 4: 32,643,810 (GRCm39) H961R probably benign Het
Cdkl3 C T 11: 51,923,176 (GRCm39) probably benign Het
Cic T A 7: 24,986,565 (GRCm39) S1299T probably damaging Het
Cic C A 7: 24,986,566 (GRCm39) S1299Y probably damaging Het
Col13a1 A G 10: 61,685,940 (GRCm39) L684P unknown Het
D430041D05Rik A T 2: 104,085,389 (GRCm39) F1053L probably benign Het
Dab1 T C 4: 104,561,396 (GRCm39) probably benign Het
Dmxl1 A T 18: 50,090,362 (GRCm39) probably benign Het
Dst C T 1: 34,228,200 (GRCm39) P1606L probably damaging Het
Eml1 T C 12: 108,502,557 (GRCm39) C708R possibly damaging Het
Fam131b T A 6: 42,295,182 (GRCm39) M304L probably benign Het
Foxk1 A T 5: 142,436,095 (GRCm39) I321F probably damaging Het
Gm10306 C T 4: 94,445,027 (GRCm39) probably benign Het
Gm10985 TA TANA 3: 53,752,677 (GRCm39) probably null Het
Gse1 T C 8: 121,293,285 (GRCm39) probably benign Het
Hcn3 A G 3: 89,067,132 (GRCm39) S79P probably damaging Het
Hspa4 T A 11: 53,174,412 (GRCm39) M203L probably benign Het
Ints15 G A 5: 143,293,817 (GRCm39) T220I probably damaging Het
Kctd7 G A 5: 130,181,414 (GRCm39) R279H probably damaging Het
Kif11 C T 19: 37,395,431 (GRCm39) probably benign Het
Klf13 T C 7: 63,541,509 (GRCm39) N206S probably benign Het
Kpna7 A T 5: 144,926,507 (GRCm39) Y482N probably damaging Het
Lamc1 T C 1: 153,138,329 (GRCm39) Y175C probably damaging Het
Lrpprc G A 17: 85,074,435 (GRCm39) R491* probably null Het
Madd T A 2: 90,982,894 (GRCm39) I1350F probably damaging Het
Mbtd1 T C 11: 93,815,375 (GRCm39) V321A possibly damaging Het
Mon2 G A 10: 122,871,953 (GRCm39) S357L possibly damaging Het
Ndst3 A G 3: 123,465,162 (GRCm39) V270A probably damaging Het
Nlrp2 T C 7: 5,325,447 (GRCm39) T742A probably damaging Het
Nopchap1 G A 10: 83,200,393 (GRCm39) probably benign Het
Or6d14 T C 6: 116,533,910 (GRCm39) S175P probably damaging Het
Papola A C 12: 105,799,395 (GRCm39) S675R probably benign Het
Pcdh9 T A 14: 94,126,081 (GRCm39) I30F probably null Het
Prl6a1 T A 13: 27,502,011 (GRCm39) L126Q probably damaging Het
Prr29 A G 11: 106,267,102 (GRCm39) E89G possibly damaging Het
Psmd1 T C 1: 86,021,987 (GRCm39) probably benign Het
Rad9b A G 5: 122,489,786 (GRCm39) probably benign Het
Rest T C 5: 77,430,398 (GRCm39) V939A probably benign Het
Rnf135 T A 11: 80,084,768 (GRCm39) S180R probably benign Het
Sarm1 C A 11: 78,378,917 (GRCm39) R376L probably damaging Het
Scap C A 9: 110,208,798 (GRCm39) P613Q probably benign Het
Scube3 C T 17: 28,383,331 (GRCm39) R374* probably null Het
Setx T G 2: 29,029,233 (GRCm39) V167G probably damaging Het
Snrnp40 T A 4: 130,262,066 (GRCm39) H151Q probably damaging Het
Sox21 G T 14: 118,473,029 (GRCm39) H7N probably benign Het
Stard9 A T 2: 120,533,982 (GRCm39) Q3413L probably benign Het
Sycp1 A G 3: 102,803,226 (GRCm39) V528A probably benign Het
Tcl1b3 A T 12: 105,157,498 (GRCm39) S47C probably damaging Het
Treml4 T C 17: 48,571,962 (GRCm39) S122P possibly damaging Het
Trip11 C T 12: 101,851,428 (GRCm39) A879T probably benign Het
Ubr4 C A 4: 139,127,704 (GRCm39) N567K probably damaging Het
Zan T C 5: 137,404,781 (GRCm39) probably benign Het
Zfp804a G A 2: 82,087,544 (GRCm39) D458N probably damaging Het
Zic2 T C 14: 122,713,755 (GRCm39) M223T possibly damaging Het
Other mutations in Anapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Anapc1 APN 2 128,487,050 (GRCm39) splice site probably benign
IGL00704:Anapc1 APN 2 128,505,904 (GRCm39) missense possibly damaging 0.48
IGL01023:Anapc1 APN 2 128,471,649 (GRCm39) missense probably damaging 1.00
IGL01432:Anapc1 APN 2 128,475,328 (GRCm39) missense probably damaging 1.00
IGL01549:Anapc1 APN 2 128,495,090 (GRCm39) missense probably benign
IGL02089:Anapc1 APN 2 128,505,853 (GRCm39) missense probably damaging 1.00
IGL02275:Anapc1 APN 2 128,501,772 (GRCm39) missense probably benign
IGL02570:Anapc1 APN 2 128,487,120 (GRCm39) missense probably damaging 1.00
IGL02597:Anapc1 APN 2 128,465,851 (GRCm39) missense probably benign 0.02
IGL02726:Anapc1 APN 2 128,501,705 (GRCm39) missense probably benign 0.05
IGL03265:Anapc1 APN 2 128,469,117 (GRCm39) missense probably damaging 1.00
IGL03304:Anapc1 APN 2 128,469,033 (GRCm39) splice site probably benign
IGL03327:Anapc1 APN 2 128,465,854 (GRCm39) missense probably benign 0.00
R0023:Anapc1 UTSW 2 128,520,138 (GRCm39) missense probably damaging 0.99
R0027:Anapc1 UTSW 2 128,483,431 (GRCm39) missense possibly damaging 0.96
R0084:Anapc1 UTSW 2 128,465,886 (GRCm39) splice site probably benign
R0103:Anapc1 UTSW 2 128,522,372 (GRCm39) splice site probably benign
R0103:Anapc1 UTSW 2 128,522,372 (GRCm39) splice site probably benign
R0109:Anapc1 UTSW 2 128,476,613 (GRCm39) missense probably damaging 1.00
R0109:Anapc1 UTSW 2 128,476,613 (GRCm39) missense probably damaging 1.00
R0241:Anapc1 UTSW 2 128,470,549 (GRCm39) missense possibly damaging 0.89
R0241:Anapc1 UTSW 2 128,470,549 (GRCm39) missense possibly damaging 0.89
R0255:Anapc1 UTSW 2 128,476,631 (GRCm39) missense probably damaging 0.99
R0377:Anapc1 UTSW 2 128,483,260 (GRCm39) critical splice donor site probably null
R0467:Anapc1 UTSW 2 128,510,963 (GRCm39) missense probably damaging 0.99
R0514:Anapc1 UTSW 2 128,474,575 (GRCm39) missense probably damaging 0.99
R0591:Anapc1 UTSW 2 128,461,252 (GRCm39) missense probably benign 0.17
R0919:Anapc1 UTSW 2 128,459,651 (GRCm39) missense probably benign
R1175:Anapc1 UTSW 2 128,522,108 (GRCm39) missense probably damaging 1.00
R1473:Anapc1 UTSW 2 128,459,617 (GRCm39) missense possibly damaging 0.88
R1547:Anapc1 UTSW 2 128,459,476 (GRCm39) missense probably benign 0.44
R1556:Anapc1 UTSW 2 128,466,819 (GRCm39) missense probably benign 0.00
R1567:Anapc1 UTSW 2 128,459,636 (GRCm39) missense probably damaging 1.00
R1635:Anapc1 UTSW 2 128,470,452 (GRCm39) missense probably damaging 1.00
R1645:Anapc1 UTSW 2 128,500,166 (GRCm39) critical splice donor site probably null
R1677:Anapc1 UTSW 2 128,518,128 (GRCm39) missense probably benign 0.09
R1854:Anapc1 UTSW 2 128,517,810 (GRCm39) missense probably damaging 1.00
R1856:Anapc1 UTSW 2 128,501,708 (GRCm39) missense probably damaging 0.96
R1959:Anapc1 UTSW 2 128,475,335 (GRCm39) missense probably benign 0.36
R1984:Anapc1 UTSW 2 128,511,608 (GRCm39) missense possibly damaging 0.85
R2034:Anapc1 UTSW 2 128,490,378 (GRCm39) missense possibly damaging 0.92
R2283:Anapc1 UTSW 2 128,484,468 (GRCm39) missense probably benign 0.23
R2928:Anapc1 UTSW 2 128,522,057 (GRCm39) missense probably damaging 1.00
R3547:Anapc1 UTSW 2 128,484,602 (GRCm39) missense possibly damaging 0.58
R3904:Anapc1 UTSW 2 128,484,439 (GRCm39) missense probably damaging 1.00
R4156:Anapc1 UTSW 2 128,469,149 (GRCm39) intron probably benign
R4359:Anapc1 UTSW 2 128,465,476 (GRCm39) missense possibly damaging 0.64
R4392:Anapc1 UTSW 2 128,518,169 (GRCm39) critical splice acceptor site probably null
R4574:Anapc1 UTSW 2 128,469,115 (GRCm39) missense probably damaging 1.00
R4682:Anapc1 UTSW 2 128,505,925 (GRCm39) missense probably benign 0.05
R4770:Anapc1 UTSW 2 128,527,980 (GRCm39) splice site probably benign
R4824:Anapc1 UTSW 2 128,470,610 (GRCm39) missense possibly damaging 0.69
R4960:Anapc1 UTSW 2 128,526,514 (GRCm39) missense probably benign 0.23
R5016:Anapc1 UTSW 2 128,449,095 (GRCm39) unclassified probably benign
R5063:Anapc1 UTSW 2 128,471,469 (GRCm39) missense possibly damaging 0.48
R5128:Anapc1 UTSW 2 128,501,837 (GRCm39) missense probably benign
R5271:Anapc1 UTSW 2 128,527,905 (GRCm39) nonsense probably null
R5363:Anapc1 UTSW 2 128,492,114 (GRCm39) critical splice donor site probably null
R5469:Anapc1 UTSW 2 128,517,621 (GRCm39) nonsense probably null
R5473:Anapc1 UTSW 2 128,449,115 (GRCm39) unclassified probably benign
R5559:Anapc1 UTSW 2 128,522,354 (GRCm39) nonsense probably null
R5631:Anapc1 UTSW 2 128,499,137 (GRCm39) missense possibly damaging 0.85
R5747:Anapc1 UTSW 2 128,466,836 (GRCm39) missense probably benign 0.19
R5840:Anapc1 UTSW 2 128,448,957 (GRCm39) unclassified probably benign
R6226:Anapc1 UTSW 2 128,492,292 (GRCm39) missense probably damaging 1.00
R6526:Anapc1 UTSW 2 128,514,055 (GRCm39) nonsense probably null
R6561:Anapc1 UTSW 2 128,505,919 (GRCm39) missense probably damaging 0.98
R6743:Anapc1 UTSW 2 128,526,454 (GRCm39) nonsense probably null
R6799:Anapc1 UTSW 2 128,501,657 (GRCm39) missense probably null 0.38
R6887:Anapc1 UTSW 2 128,501,688 (GRCm39) missense possibly damaging 0.91
R6978:Anapc1 UTSW 2 128,511,820 (GRCm39) missense probably benign 0.06
R7011:Anapc1 UTSW 2 128,490,601 (GRCm39) splice site probably null
R7041:Anapc1 UTSW 2 128,470,576 (GRCm39) missense possibly damaging 0.88
R7047:Anapc1 UTSW 2 128,457,350 (GRCm39) missense probably damaging 0.96
R7074:Anapc1 UTSW 2 128,520,194 (GRCm39) missense probably damaging 1.00
R7109:Anapc1 UTSW 2 128,516,522 (GRCm39) missense probably benign 0.33
R7123:Anapc1 UTSW 2 128,454,930 (GRCm39) missense probably damaging 1.00
R7309:Anapc1 UTSW 2 128,516,604 (GRCm39) missense probably damaging 0.96
R7693:Anapc1 UTSW 2 128,483,457 (GRCm39) missense possibly damaging 0.86
R7839:Anapc1 UTSW 2 128,526,528 (GRCm39) missense probably damaging 0.99
R7847:Anapc1 UTSW 2 128,511,828 (GRCm39) missense possibly damaging 0.93
R7960:Anapc1 UTSW 2 128,516,513 (GRCm39) missense probably damaging 1.00
R8061:Anapc1 UTSW 2 128,490,408 (GRCm39) missense probably damaging 0.98
R8127:Anapc1 UTSW 2 128,474,547 (GRCm39) missense probably damaging 0.96
R8228:Anapc1 UTSW 2 128,461,837 (GRCm39) nonsense probably null
R8402:Anapc1 UTSW 2 128,472,148 (GRCm39) missense probably benign 0.02
R8422:Anapc1 UTSW 2 128,517,757 (GRCm39) missense probably benign
R8425:Anapc1 UTSW 2 128,511,788 (GRCm39) missense probably damaging 1.00
R8469:Anapc1 UTSW 2 128,500,264 (GRCm39) splice site probably null
R8553:Anapc1 UTSW 2 128,461,833 (GRCm39) missense possibly damaging 0.80
R8688:Anapc1 UTSW 2 128,527,748 (GRCm39) missense probably benign 0.19
R8699:Anapc1 UTSW 2 128,483,373 (GRCm39) missense probably damaging 1.00
R8719:Anapc1 UTSW 2 128,483,369 (GRCm39) missense probably damaging 1.00
R8775:Anapc1 UTSW 2 128,499,093 (GRCm39) missense possibly damaging 0.92
R8775-TAIL:Anapc1 UTSW 2 128,499,093 (GRCm39) missense possibly damaging 0.92
R8806:Anapc1 UTSW 2 128,464,333 (GRCm39) missense possibly damaging 0.67
R8973:Anapc1 UTSW 2 128,505,952 (GRCm39) missense probably damaging 0.99
R8977:Anapc1 UTSW 2 128,483,322 (GRCm39) missense probably damaging 1.00
R9000:Anapc1 UTSW 2 128,476,628 (GRCm39) missense probably damaging 1.00
R9080:Anapc1 UTSW 2 128,464,426 (GRCm39) missense possibly damaging 0.82
R9203:Anapc1 UTSW 2 128,465,422 (GRCm39) missense possibly damaging 0.66
R9314:Anapc1 UTSW 2 128,464,420 (GRCm39) missense possibly damaging 0.69
R9386:Anapc1 UTSW 2 128,459,642 (GRCm39) missense probably benign 0.08
R9415:Anapc1 UTSW 2 128,476,598 (GRCm39) missense probably benign
R9436:Anapc1 UTSW 2 128,518,045 (GRCm39) missense probably benign
R9516:Anapc1 UTSW 2 128,517,633 (GRCm39) missense possibly damaging 0.77
R9563:Anapc1 UTSW 2 128,505,980 (GRCm39) nonsense probably null
R9572:Anapc1 UTSW 2 128,505,976 (GRCm39) missense probably benign
R9757:Anapc1 UTSW 2 128,517,676 (GRCm39) missense probably damaging 1.00
R9766:Anapc1 UTSW 2 128,500,221 (GRCm39) missense probably damaging 1.00
X0066:Anapc1 UTSW 2 128,516,621 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGGCCCCATTACTTGTGAGCTTTG -3'
(R):5'- TGAAAGAGGCTGGCACCGTTCTAC -3'

Sequencing Primer
(F):5'- TGTACACCTGTAAGAATTCAGCAC -3'
(R):5'- cggaggtgaagaaaagaggag -3'
Posted On 2013-06-11