Incidental Mutation 'R5755:Dcaf12'
ID444991
Institutional Source Beutler Lab
Gene Symbol Dcaf12
Ensembl Gene ENSMUSG00000028436
Gene NameDDB1 and CUL4 associated factor 12
Synonyms1500001L20Rik, Wdr40a, 5830424K06Rik
MMRRC Submission 043202-MU
Accession Numbers

Genbank: NM_026893; MGI: 1916220  

Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R5755 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location41291300-41314889 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41313356 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 63 (Y63C)
Ref Sequence ENSEMBL: ENSMUSP00000030145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030145]
Predicted Effect probably damaging
Transcript: ENSMUST00000030145
AA Change: Y63C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030145
Gene: ENSMUSG00000028436
AA Change: Y63C

DomainStartEndE-ValueType
WD40 77 116 1.53e2 SMART
Blast:WD40 121 169 5e-20 BLAST
WD40 172 211 3.75e-4 SMART
WD40 236 280 4.44e0 SMART
Blast:WD40 284 323 7e-7 BLAST
WD40 328 366 2.37e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157313
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein that interacts with the COP9 signalosome, a macromolecular complex that interacts with cullin-RING E3 ligases and regulates their activity by hydrolyzing cullin-Nedd8 conjugates. [provided by RefSeq, Jul 2009]
Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,398,454 F1042I probably damaging Het
Ahnak A G 19: 9,001,732 T127A probably benign Het
Aloxe3 A G 11: 69,132,749 I233V probably benign Het
Ambn T A 5: 88,464,491 probably null Het
Atp2b1 T C 10: 98,994,809 probably null Het
Atp2b1 A G 10: 99,003,170 E39G probably damaging Het
Camsap2 C T 1: 136,282,327 G476R probably damaging Het
Ccdc144b A T 3: 36,017,693 M501K probably benign Het
Cdk4 T A 10: 127,064,722 probably null Het
Dtna T A 18: 23,621,463 S445T probably benign Het
Ehmt2 T C 17: 34,908,238 M109T probably benign Het
Erbb4 T C 1: 68,560,519 E133G possibly damaging Het
F830016B08Rik T A 18: 60,300,806 F320L probably damaging Het
Fyco1 A G 9: 123,828,708 V801A possibly damaging Het
Jag1 T A 2: 137,088,690 N674Y probably damaging Het
Kcnj10 A G 1: 172,369,594 E225G possibly damaging Het
Klhl11 T A 11: 100,464,351 M215L probably benign Het
Kmt2d G T 15: 98,863,646 P608T unknown Het
Map3k19 T C 1: 127,822,381 M1078V probably benign Het
Neto1 T C 18: 86,499,094 V512A probably damaging Het
Notch1 T C 2: 26,473,692 D910G probably benign Het
Olfr263 T A 13: 21,133,525 I250K probably damaging Het
Olfr378 T A 11: 73,425,731 N84I probably benign Het
Parvg T C 15: 84,331,096 probably null Het
Pi4kb A T 3: 94,994,297 probably null Het
Plag1 T C 4: 3,904,492 K233R possibly damaging Het
Rasgrp3 A C 17: 75,524,945 D587A probably benign Het
Slc7a10 A T 7: 35,198,911 I336F probably damaging Het
Snx8 T G 5: 140,353,041 E254A possibly damaging Het
Sp3 A T 2: 72,938,381 silent Het
Sp8 G T 12: 118,849,087 A226S probably damaging Het
Spata31d1c C A 13: 65,036,527 Q628K probably benign Het
Styx C A 14: 45,368,453 T138K probably benign Het
Syngr3 A G 17: 24,686,535 F155S probably damaging Het
Trip11 C T 12: 101,885,665 W428* probably null Het
Ubr4 A G 4: 139,460,095 T3825A possibly damaging Het
Vmn2r113 A T 17: 22,957,981 T580S probably benign Het
Zbtb11 T A 16: 56,000,713 S724R probably benign Het
Zcchc4 T C 5: 52,816,169 S379P probably benign Het
Znrd1 T A 17: 36,958,157 D43V probably benign Het
Other mutations in Dcaf12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01988:Dcaf12 APN 4 41298299 missense probably benign
IGL02252:Dcaf12 APN 4 41294085 missense probably benign 0.17
IGL02508:Dcaf12 APN 4 41296310 critical splice donor site probably null
R0066:Dcaf12 UTSW 4 41298338 missense probably damaging 0.98
R0066:Dcaf12 UTSW 4 41298338 missense probably damaging 0.98
R0382:Dcaf12 UTSW 4 41302672 missense probably damaging 1.00
R2001:Dcaf12 UTSW 4 41302804 missense probably damaging 1.00
R2095:Dcaf12 UTSW 4 41294085 missense probably benign 0.17
R5109:Dcaf12 UTSW 4 41298329 missense possibly damaging 0.89
R5434:Dcaf12 UTSW 4 41302744 missense probably benign 0.00
R6016:Dcaf12 UTSW 4 41313267 missense probably damaging 1.00
R6160:Dcaf12 UTSW 4 41294043 missense probably damaging 1.00
R7092:Dcaf12 UTSW 4 41301366 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGACAAAGAGCACTCCTGATAC -3'
(R):5'- GCCTTATTTCAGTGCTAGCCG -3'

Sequencing Primer
(F):5'- AGAGCACTCCTGATACTTACTGTG -3'
(R):5'- CAGTGCTAGCCGAGTTAAACTGTAC -3'
Posted On2016-11-21