Incidental Mutation 'R5756:Pde7a'
ID445031
Institutional Source Beutler Lab
Gene Symbol Pde7a
Ensembl Gene ENSMUSG00000069094
Gene Namephosphodiesterase 7A
Synonyms
MMRRC Submission 043359-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R5756 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location19223108-19311322 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19264845 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 12 (V12A)
Ref Sequence ENSEMBL: ENSMUSP00000088863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091314] [ENSMUST00000099195] [ENSMUST00000121951] [ENSMUST00000149081] [ENSMUST00000156652]
Predicted Effect probably benign
Transcript: ENSMUST00000091314
AA Change: V12A

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000088863
Gene: ENSMUSG00000069094
AA Change: V12A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
HDc 183 350 2.91e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099195
SMART Domains Protein: ENSMUSP00000096800
Gene: ENSMUSG00000069094

DomainStartEndE-ValueType
low complexity region 21 37 N/A INTRINSIC
HDc 209 376 2.91e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121951
AA Change: V12A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000113173
Gene: ENSMUSG00000069094
AA Change: V12A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143120
Predicted Effect probably benign
Transcript: ENSMUST00000149081
Predicted Effect probably benign
Transcript: ENSMUST00000156652
SMART Domains Protein: ENSMUSP00000119685
Gene: ENSMUSG00000069094

DomainStartEndE-ValueType
low complexity region 21 37 N/A INTRINSIC
Meta Mutation Damage Score 0.196 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE7 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygous inactivation of this locus does not impair T cell function but affects the humoral immune response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik A G 9: 89,128,866 noncoding transcript Het
9330182L06Rik A C 5: 9,462,995 K996N probably damaging Het
Aqp6 A T 15: 99,602,742 I183F probably damaging Het
Asap1 A T 15: 64,167,707 M218K probably damaging Het
Astn2 G A 4: 66,119,188 probably benign Het
Bmp5 A G 9: 75,776,367 D92G probably benign Het
Cables1 A G 18: 11,941,353 D511G probably damaging Het
Cacna1e A G 1: 154,471,637 M928T probably benign Het
Calcoco1 T C 15: 102,719,651 N16S probably benign Het
Coro7 C T 16: 4,632,284 R567Q probably damaging Het
Dgki C T 6: 36,937,058 probably benign Het
Dusp11 T C 6: 85,952,357 I147V probably damaging Het
Eif2ak4 T C 2: 118,462,740 I1259T possibly damaging Het
Etfdh T C 3: 79,613,756 I219V probably benign Het
Ffar4 C T 19: 38,113,958 T347I probably damaging Het
Fgf3 G A 7: 144,842,951 S234N probably benign Het
Fnta A T 8: 26,009,707 I155N possibly damaging Het
Gcm2 G A 13: 41,109,896 T20M probably damaging Het
Ggt5 A T 10: 75,604,773 M243L probably benign Het
Ggta1 T C 2: 35,402,383 Y304C probably damaging Het
Gm16432 A T 1: 178,116,227 Q710L unknown Het
Gm5454 A G 13: 103,356,347 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hrc T C 7: 45,336,706 V427A possibly damaging Het
Ibtk C G 9: 85,731,254 V219L possibly damaging Het
Ift140 A G 17: 25,028,813 H215R possibly damaging Het
Itln1 A G 1: 171,516,917 probably benign Het
Kif13b T C 14: 64,736,305 I368T probably damaging Het
Lars2 T C 9: 123,438,199 Y529H probably damaging Het
Lrrc55 G A 2: 85,196,383 T99I probably benign Het
Mycbp2 A T 14: 103,133,974 I4156N probably damaging Het
Myo1c T G 11: 75,658,414 M137R probably benign Het
Olfr640 T C 7: 104,021,682 D212G probably damaging Het
Olfr765 A G 10: 129,046,226 V279A probably benign Het
Olfr921 T A 9: 38,775,258 M1K probably null Het
Phyhip T G 14: 70,467,092 C250W probably damaging Het
Pisd G A 5: 32,738,498 T412I probably damaging Het
Polr3c T C 3: 96,714,134 N444S probably damaging Het
Sart1 T C 19: 5,380,469 E750G probably damaging Het
Sh3rf3 T C 10: 59,104,382 V675A probably damaging Het
Slc4a11 G T 2: 130,687,863 D307E probably benign Het
Slc6a16 A T 7: 45,260,850 I315F possibly damaging Het
Smarca5 A C 8: 80,710,604 S708A probably benign Het
Sv2c T C 13: 95,985,967 I434V probably benign Het
Tarsl2 A G 7: 65,675,976 K433E probably benign Het
Tbx15 A T 3: 99,313,086 I165F probably damaging Het
Tep1 C T 14: 50,837,379 probably null Het
Tex15 G A 8: 33,575,833 G1764S probably benign Het
Tnfrsf19 A G 14: 61,024,775 L13P probably benign Het
Tnnt3 G A 7: 142,502,758 probably null Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Usp24 T A 4: 106,362,483 I597K probably damaging Het
Usp40 C T 1: 87,951,691 R960Q possibly damaging Het
Vps53 A T 11: 76,092,330 probably benign Het
Xylt1 C T 7: 117,650,700 T699I probably damaging Het
Zfp81 A C 17: 33,334,333 Y502* probably null Het
Zfyve26 T A 12: 79,264,357 H145L probably damaging Het
Other mutations in Pde7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Pde7a APN 3 19229679 unclassified probably benign
IGL02644:Pde7a APN 3 19256867 splice site probably benign
IGL02968:Pde7a APN 3 19243121 nonsense probably null
IGL02985:Pde7a APN 3 19310883 missense probably damaging 1.00
R0081:Pde7a UTSW 3 19241533 splice site probably benign
R0736:Pde7a UTSW 3 19231043 missense probably damaging 1.00
R0834:Pde7a UTSW 3 19230318 missense probably damaging 1.00
R1499:Pde7a UTSW 3 19260244 missense possibly damaging 0.49
R1955:Pde7a UTSW 3 19227799 missense probably damaging 0.99
R2943:Pde7a UTSW 3 19230325 missense probably damaging 1.00
R4072:Pde7a UTSW 3 19256853 missense probably damaging 1.00
R4366:Pde7a UTSW 3 19310862 critical splice donor site probably null
R4524:Pde7a UTSW 3 19230976 missense possibly damaging 0.93
R4666:Pde7a UTSW 3 19260256 missense probably damaging 1.00
R4698:Pde7a UTSW 3 19310931 missense probably damaging 0.99
R4850:Pde7a UTSW 3 19243117 missense probably benign
R4859:Pde7a UTSW 3 19241491 intron probably benign
R5283:Pde7a UTSW 3 19260256 missense probably damaging 1.00
R5646:Pde7a UTSW 3 19233773 missense probably damaging 1.00
R5702:Pde7a UTSW 3 19241207 nonsense probably null
R5784:Pde7a UTSW 3 19264845 missense probably benign 0.08
R6301:Pde7a UTSW 3 19243163 missense probably benign 0.01
R7136:Pde7a UTSW 3 19231094 missense probably benign 0.36
R7291:Pde7a UTSW 3 19227674 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTAAAGGGAAGCTGCTTTGC -3'
(R):5'- TCAGCTGATCACTGTCTGGAG -3'

Sequencing Primer
(F):5'- GCCTGTAAGAGCAATAACACG -3'
(R):5'- TGATCACTGTCTGGAGGCAGC -3'
Posted On2016-11-21