Incidental Mutation 'R5756:Polr3c'
ID445033
Institutional Source Beutler Lab
Gene Symbol Polr3c
Ensembl Gene ENSMUSG00000028099
Gene Namepolymerase (RNA) III (DNA directed) polypeptide C
Synonyms4933407E01Rik, RPC62, RPC3
MMRRC Submission 043359-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R5756 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96711490-96727628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96714134 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 444 (N444S)
Ref Sequence ENSEMBL: ENSMUSP00000122435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029741] [ENSMUST00000154679]
Predicted Effect probably damaging
Transcript: ENSMUST00000029741
AA Change: N444S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029741
Gene: ENSMUSG00000028099
AA Change: N444S

DomainStartEndE-ValueType
Pfam:HTH_9 7 68 9.4e-26 PFAM
Pfam:RNA_pol_Rpc82 146 344 7.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128918
SMART Domains Protein: ENSMUSP00000119236
Gene: ENSMUSG00000028099

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpc82 20 180 5.9e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137009
Predicted Effect probably damaging
Transcript: ENSMUST00000154679
AA Change: N444S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122435
Gene: ENSMUSG00000028099
AA Change: N444S

DomainStartEndE-ValueType
Pfam:HTH_9 7 68 1.6e-26 PFAM
Pfam:RNA_pol_Rpc82 146 344 7.6e-46 PFAM
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik A G 9: 89,128,866 noncoding transcript Het
9330182L06Rik A C 5: 9,462,995 K996N probably damaging Het
Aqp6 A T 15: 99,602,742 I183F probably damaging Het
Asap1 A T 15: 64,167,707 M218K probably damaging Het
Astn2 G A 4: 66,119,188 probably benign Het
Bmp5 A G 9: 75,776,367 D92G probably benign Het
Cables1 A G 18: 11,941,353 D511G probably damaging Het
Cacna1e A G 1: 154,471,637 M928T probably benign Het
Calcoco1 T C 15: 102,719,651 N16S probably benign Het
Coro7 C T 16: 4,632,284 R567Q probably damaging Het
Dgki C T 6: 36,937,058 probably benign Het
Dusp11 T C 6: 85,952,357 I147V probably damaging Het
Eif2ak4 T C 2: 118,462,740 I1259T possibly damaging Het
Etfdh T C 3: 79,613,756 I219V probably benign Het
Ffar4 C T 19: 38,113,958 T347I probably damaging Het
Fgf3 G A 7: 144,842,951 S234N probably benign Het
Fnta A T 8: 26,009,707 I155N possibly damaging Het
Gcm2 G A 13: 41,109,896 T20M probably damaging Het
Ggt5 A T 10: 75,604,773 M243L probably benign Het
Ggta1 T C 2: 35,402,383 Y304C probably damaging Het
Gm16432 A T 1: 178,116,227 Q710L unknown Het
Gm5454 A G 13: 103,356,347 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hrc T C 7: 45,336,706 V427A possibly damaging Het
Ibtk C G 9: 85,731,254 V219L possibly damaging Het
Ift140 A G 17: 25,028,813 H215R possibly damaging Het
Itln1 A G 1: 171,516,917 probably benign Het
Kif13b T C 14: 64,736,305 I368T probably damaging Het
Lars2 T C 9: 123,438,199 Y529H probably damaging Het
Lrrc55 G A 2: 85,196,383 T99I probably benign Het
Mycbp2 A T 14: 103,133,974 I4156N probably damaging Het
Myo1c T G 11: 75,658,414 M137R probably benign Het
Olfr640 T C 7: 104,021,682 D212G probably damaging Het
Olfr765 A G 10: 129,046,226 V279A probably benign Het
Olfr921 T A 9: 38,775,258 M1K probably null Het
Pde7a A G 3: 19,264,845 V12A probably benign Het
Phyhip T G 14: 70,467,092 C250W probably damaging Het
Pisd G A 5: 32,738,498 T412I probably damaging Het
Sart1 T C 19: 5,380,469 E750G probably damaging Het
Sh3rf3 T C 10: 59,104,382 V675A probably damaging Het
Slc4a11 G T 2: 130,687,863 D307E probably benign Het
Slc6a16 A T 7: 45,260,850 I315F possibly damaging Het
Smarca5 A C 8: 80,710,604 S708A probably benign Het
Sv2c T C 13: 95,985,967 I434V probably benign Het
Tarsl2 A G 7: 65,675,976 K433E probably benign Het
Tbx15 A T 3: 99,313,086 I165F probably damaging Het
Tep1 C T 14: 50,837,379 probably null Het
Tex15 G A 8: 33,575,833 G1764S probably benign Het
Tnfrsf19 A G 14: 61,024,775 L13P probably benign Het
Tnnt3 G A 7: 142,502,758 probably null Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Usp24 T A 4: 106,362,483 I597K probably damaging Het
Usp40 C T 1: 87,951,691 R960Q possibly damaging Het
Vps53 A T 11: 76,092,330 probably benign Het
Xylt1 C T 7: 117,650,700 T699I probably damaging Het
Zfp81 A C 17: 33,334,333 Y502* probably null Het
Zfyve26 T A 12: 79,264,357 H145L probably damaging Het
Other mutations in Polr3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Polr3c APN 3 96713520 missense probably damaging 1.00
IGL01904:Polr3c APN 3 96716665 critical splice donor site probably null
IGL01964:Polr3c APN 3 96711975 unclassified probably benign
IGL02640:Polr3c APN 3 96716686 missense probably damaging 0.98
IGL02955:Polr3c APN 3 96714312 missense probably damaging 1.00
IGL03129:Polr3c APN 3 96719454 splice site probably benign
IGL03263:Polr3c APN 3 96714251 splice site probably benign
R0503:Polr3c UTSW 3 96713636 splice site probably null
R0800:Polr3c UTSW 3 96719311 missense probably damaging 0.99
R0881:Polr3c UTSW 3 96723847 missense probably damaging 0.99
R1763:Polr3c UTSW 3 96713595 missense probably damaging 1.00
R1931:Polr3c UTSW 3 96719298 missense probably damaging 1.00
R1932:Polr3c UTSW 3 96719298 missense probably damaging 1.00
R1994:Polr3c UTSW 3 96714373 splice site probably null
R3771:Polr3c UTSW 3 96725854 missense probably damaging 1.00
R4116:Polr3c UTSW 3 96715244 missense probably damaging 1.00
R4614:Polr3c UTSW 3 96716471 missense probably benign 0.00
R4732:Polr3c UTSW 3 96723661 missense probably damaging 1.00
R4733:Polr3c UTSW 3 96723661 missense probably damaging 1.00
R5057:Polr3c UTSW 3 96712057 missense probably damaging 0.98
R5058:Polr3c UTSW 3 96723517 missense probably benign 0.01
R6005:Polr3c UTSW 3 96719468 missense possibly damaging 0.96
R6009:Polr3c UTSW 3 96713614 missense probably damaging 1.00
R6580:Polr3c UTSW 3 96727343 splice site probably null
R7003:Polr3c UTSW 3 96723638 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATTGGGCTATGGTCTCCATTTC -3'
(R):5'- CTGTGAATGTGCTCTCAGCTG -3'

Sequencing Primer
(F):5'- CAGGCTCTGGACCTTGGAAATG -3'
(R):5'- AATGTGCTCTCAGCTGCCAGG -3'
Posted On2016-11-21