Incidental Mutation 'R5757:Obsl1'
ID445080
Institutional Source Beutler Lab
Gene Symbol Obsl1
Ensembl Gene ENSMUSG00000026211
Gene Nameobscurin-like 1
Synonyms
MMRRC Submission 043360-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.354) question?
Stock #R5757 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location75479310-75506452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 75493055 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 1106 (A1106D)
Ref Sequence ENSEMBL: ENSMUSP00000109197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113565] [ENSMUST00000113567]
Predicted Effect probably benign
Transcript: ENSMUST00000113565
SMART Domains Protein: ENSMUSP00000109195
Gene: ENSMUSG00000026211

DomainStartEndE-ValueType
IGc2 24 91 1.23e-12 SMART
IGc2 140 216 2.33e-13 SMART
IGc2 258 326 1.48e-6 SMART
IG 347 427 9.49e-5 SMART
IG 435 511 1.04e-1 SMART
FN3 518 601 6.6e-2 SMART
PDB:2E6Q|A 608 714 5e-57 PDB
Blast:IG_like 622 711 2e-50 BLAST
IG 723 804 3.79e-4 SMART
IG 814 893 2.58e-6 SMART
IGc2 911 977 1.12e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113567
AA Change: A1106D

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109197
Gene: ENSMUSG00000026211
AA Change: A1106D

DomainStartEndE-ValueType
IGc2 24 91 1.23e-12 SMART
IGc2 140 216 2.33e-13 SMART
IGc2 258 326 1.48e-6 SMART
IG 347 427 9.49e-5 SMART
IG 435 511 1.04e-1 SMART
FN3 518 601 6.6e-2 SMART
PDB:2E6Q|A 608 714 8e-57 PDB
Blast:IG_like 622 711 3e-50 BLAST
IG 723 804 3.79e-4 SMART
IG 814 893 2.58e-6 SMART
IGc2 911 977 1.12e-6 SMART
IG 996 1075 1.27e-5 SMART
IGc2 1094 1160 4.07e-4 SMART
IGc2 1186 1252 9.49e-5 SMART
IG 1274 1353 7.41e-7 SMART
IG 1363 1444 1.15e-3 SMART
IG 1454 1533 8.33e-1 SMART
IGc2 1549 1615 8.72e-4 SMART
IG 1633 1712 1e-3 SMART
IG 1723 1802 3.82e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127507
Predicted Effect unknown
Transcript: ENSMUST00000132252
AA Change: A4D
SMART Domains Protein: ENSMUSP00000117420
Gene: ENSMUSG00000026211
AA Change: A4D

DomainStartEndE-ValueType
IG_like 1 59 2.8e-1 SMART
IGc2 85 151 9.49e-5 SMART
IG 175 254 2.64e-3 SMART
IG 265 344 7.41e-7 SMART
Blast:IG 354 417 4e-35 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150293
Predicted Effect unknown
Transcript: ENSMUST00000155084
AA Change: A911D
SMART Domains Protein: ENSMUSP00000114553
Gene: ENSMUSG00000026211
AA Change: A911D

DomainStartEndE-ValueType
SCOP:d1g1ca_ 2 32 1e-3 SMART
IGc2 64 132 1.48e-6 SMART
IG 153 233 9.49e-5 SMART
IG 241 317 1.04e-1 SMART
FN3 324 407 6.6e-2 SMART
PDB:2E6Q|A 414 520 4e-57 PDB
Blast:IG_like 428 517 2e-50 BLAST
IG 529 610 3.79e-4 SMART
IG 620 699 2.58e-6 SMART
IGc2 717 783 1.12e-6 SMART
IG 802 881 1.27e-5 SMART
IGc2 900 966 4.07e-4 SMART
IGc2 992 1058 9.49e-5 SMART
IG 1080 1159 7.41e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156705
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a C T 11: 110,042,968 A1204T probably benign Het
Adcy5 G T 16: 35,272,081 R604L probably damaging Het
Ago4 A T 4: 126,526,084 N33K probably damaging Het
Arid5b T C 10: 68,102,079 Y406C probably damaging Het
Asgr1 A C 11: 70,054,952 H18P probably benign Het
Asph A C 4: 9,637,722 probably null Het
Brd4 G A 17: 32,201,298 probably benign Het
Ccdc150 T A 1: 54,263,620 I133N probably damaging Het
Cdon A C 9: 35,452,772 H62P probably damaging Het
Clec4b1 T A 6: 123,069,754 Y157* probably null Het
Clip1 G A 5: 123,627,397 T810I probably benign Het
Crocc A T 4: 141,043,564 L184Q probably damaging Het
Fat2 C T 11: 55,252,346 G4226R probably damaging Het
Fbxo30 T A 10: 11,290,421 C296S probably benign Het
Fndc3a T C 14: 72,556,585 K883E probably benign Het
Glyr1 A T 16: 5,018,992 M436K probably benign Het
Gm525 A T 11: 89,075,046 Q38L probably benign Het
Gnas T A 2: 174,345,247 V941D probably damaging Het
Hectd4 G C 5: 121,348,619 E3226Q possibly damaging Het
Ints13 G A 6: 146,550,106 R714C probably benign Het
Kif12 A T 4: 63,170,518 W182R probably damaging Het
Kif21a A G 15: 90,951,345 L1272P probably damaging Het
Klhl14 A C 18: 21,554,734 Y544D probably damaging Het
Kntc1 T C 5: 123,807,309 probably null Het
Lama1 G A 17: 67,738,787 R229Q possibly damaging Het
Ltbp1 T A 17: 75,273,949 probably null Het
Map4k5 A T 12: 69,824,655 C498S probably damaging Het
Myh9 A T 15: 77,771,162 V1198E probably benign Het
Ncoa6 T C 2: 155,411,608 D950G probably damaging Het
Olfr1034 T A 2: 86,046,566 V28E possibly damaging Het
Olfr1065 T C 2: 86,445,578 I135V probably benign Het
Otog T A 7: 46,241,121 probably null Het
Oxtr A T 6: 112,477,261 I14N probably damaging Het
Pfkfb3 A T 2: 11,480,330 S490R probably damaging Het
Polk A C 13: 96,484,252 M560R probably benign Het
Polq C T 16: 37,086,681 H2335Y probably benign Het
Prr14 T A 7: 127,475,553 V419D possibly damaging Het
Rflnb A G 11: 76,022,166 V132A probably damaging Het
Rxfp1 T G 3: 79,661,320 I283L possibly damaging Het
Ryr3 G A 2: 112,841,975 R1384C probably damaging Het
Scnn1g T A 7: 121,738,215 C100S probably damaging Het
Sfrp2 G C 3: 83,766,626 G29R possibly damaging Het
Spop A G 11: 95,490,382 H312R probably damaging Het
Tpx2 A G 2: 152,885,231 probably null Het
Wdr4 A T 17: 31,499,089 V337E probably damaging Het
Zbtb11 A G 16: 56,007,029 N953D probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Obsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Obsl1 APN 1 75490874 missense probably benign 0.02
IGL01111:Obsl1 APN 1 75497145 missense possibly damaging 0.62
IGL01140:Obsl1 APN 1 75489756 unclassified probably benign
IGL02149:Obsl1 APN 1 75503820 missense probably damaging 1.00
IGL02225:Obsl1 APN 1 75503798 missense probably damaging 0.99
IGL02269:Obsl1 APN 1 75487713 missense probably damaging 0.97
IGL02296:Obsl1 APN 1 75498149 missense possibly damaging 0.94
IGL02386:Obsl1 APN 1 75492517 missense probably damaging 1.00
IGL02408:Obsl1 APN 1 75505246 missense probably damaging 0.98
IGL02601:Obsl1 APN 1 75489620 missense probably benign
IGL03053:Obsl1 APN 1 75493079 missense probably benign
IGL03181:Obsl1 APN 1 75492584 missense probably benign 0.00
IGL03402:Obsl1 APN 1 75486799 missense probably benign 0.00
PIT1430001:Obsl1 UTSW 1 75506167 missense probably damaging 1.00
PIT4382001:Obsl1 UTSW 1 75487963 missense probably benign 0.06
R0281:Obsl1 UTSW 1 75492927 missense probably damaging 1.00
R1343:Obsl1 UTSW 1 75492579 missense probably damaging 1.00
R1394:Obsl1 UTSW 1 75492665 missense probably damaging 0.96
R1395:Obsl1 UTSW 1 75492665 missense probably damaging 0.96
R1439:Obsl1 UTSW 1 75486784 nonsense probably null
R1456:Obsl1 UTSW 1 75487656 nonsense probably null
R1728:Obsl1 UTSW 1 75486756 missense probably benign
R1729:Obsl1 UTSW 1 75486756 missense probably benign
R1730:Obsl1 UTSW 1 75486756 missense probably benign
R1739:Obsl1 UTSW 1 75486756 missense probably benign
R1757:Obsl1 UTSW 1 75493883 missense probably benign
R1762:Obsl1 UTSW 1 75486756 missense probably benign
R1783:Obsl1 UTSW 1 75486756 missense probably benign
R1784:Obsl1 UTSW 1 75486756 missense probably benign
R1785:Obsl1 UTSW 1 75486756 missense probably benign
R1851:Obsl1 UTSW 1 75492893 missense probably damaging 1.00
R1864:Obsl1 UTSW 1 75493109 missense probably benign 0.01
R1873:Obsl1 UTSW 1 75498233 missense probably damaging 1.00
R1875:Obsl1 UTSW 1 75498233 missense probably damaging 1.00
R1980:Obsl1 UTSW 1 75505836 missense probably damaging 1.00
R1985:Obsl1 UTSW 1 75505600 missense probably damaging 1.00
R2049:Obsl1 UTSW 1 75486756 missense probably benign
R2069:Obsl1 UTSW 1 75486756 missense probably benign
R2122:Obsl1 UTSW 1 75493883 missense probably benign
R2141:Obsl1 UTSW 1 75486756 missense probably benign
R2142:Obsl1 UTSW 1 75486756 missense probably benign
R2184:Obsl1 UTSW 1 75502217 missense probably benign 0.26
R2267:Obsl1 UTSW 1 75505698 missense probably damaging 1.00
R2883:Obsl1 UTSW 1 75496511 missense possibly damaging 0.73
R3079:Obsl1 UTSW 1 75490823 missense probably damaging 1.00
R3749:Obsl1 UTSW 1 75498246 missense probably benign
R4002:Obsl1 UTSW 1 75500099 missense possibly damaging 0.90
R4365:Obsl1 UTSW 1 75488049 missense possibly damaging 0.91
R4366:Obsl1 UTSW 1 75488049 missense possibly damaging 0.91
R4414:Obsl1 UTSW 1 75490902 missense probably benign 0.00
R4700:Obsl1 UTSW 1 75503441 missense probably damaging 1.00
R4799:Obsl1 UTSW 1 75489501 missense possibly damaging 0.93
R5081:Obsl1 UTSW 1 75487963 missense possibly damaging 0.49
R5389:Obsl1 UTSW 1 75503261 intron probably benign
R5890:Obsl1 UTSW 1 75493859 missense probably damaging 1.00
R5946:Obsl1 UTSW 1 75491207 missense probably damaging 0.96
R6005:Obsl1 UTSW 1 75492215 unclassified probably null
R6118:Obsl1 UTSW 1 75492078 intron probably benign
R6154:Obsl1 UTSW 1 75500144 missense probably benign 0.19
R6317:Obsl1 UTSW 1 75489629 missense possibly damaging 0.50
R6379:Obsl1 UTSW 1 75503143 missense probably damaging 1.00
R6387:Obsl1 UTSW 1 75491362 missense probably benign 0.03
R7084:Obsl1 UTSW 1 75487750 missense probably benign
R7123:Obsl1 UTSW 1 75489669 missense probably damaging 1.00
V8831:Obsl1 UTSW 1 75486756 missense probably benign
X0061:Obsl1 UTSW 1 75486768 missense probably benign
Z1088:Obsl1 UTSW 1 75486756 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACGTTGAAGGTGACAGCC -3'
(R):5'- TTATCTGTATGATCTTGGGCAAGTC -3'

Sequencing Primer
(F):5'- TTGAAGGTGACAGCCTCATC -3'
(R):5'- GGCAAGTCCTTTTCTTCATAGGAGC -3'
Posted On2016-11-21