Incidental Mutation 'R5757:Olfr1065'
ID445086
Institutional Source Beutler Lab
Gene Symbol Olfr1065
Ensembl Gene ENSMUSG00000111306
Gene Nameolfactory receptor 1065
SynonymsMOR190-1, GA_x6K02T2Q125-47915274-47914333
MMRRC Submission 043360-MU
Accession Numbers

Genbank: NM_146408; MGI: 3030899

Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R5757 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86443958-86450591 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86445578 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 135 (I135V)
Ref Sequence ENSEMBL: ENSMUSP00000149248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000213789] [ENSMUST00000216162] [ENSMUST00000216165] [ENSMUST00000217586]
Predicted Effect probably benign
Transcript: ENSMUST00000099886
AA Change: I135V

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097471
Gene: ENSMUSG00000075182
AA Change: I135V

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.1e-53 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213789
AA Change: I135V

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000216162
AA Change: I135V

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000216165
AA Change: I135V

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000217586
AA Change: I135V

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a C T 11: 110,042,968 A1204T probably benign Het
Adcy5 G T 16: 35,272,081 R604L probably damaging Het
Ago4 A T 4: 126,526,084 N33K probably damaging Het
Arid5b T C 10: 68,102,079 Y406C probably damaging Het
Asgr1 A C 11: 70,054,952 H18P probably benign Het
Asph A C 4: 9,637,722 probably null Het
Brd4 G A 17: 32,201,298 probably benign Het
Ccdc150 T A 1: 54,263,620 I133N probably damaging Het
Cdon A C 9: 35,452,772 H62P probably damaging Het
Clec4b1 T A 6: 123,069,754 Y157* probably null Het
Clip1 G A 5: 123,627,397 T810I probably benign Het
Crocc A T 4: 141,043,564 L184Q probably damaging Het
Fat2 C T 11: 55,252,346 G4226R probably damaging Het
Fbxo30 T A 10: 11,290,421 C296S probably benign Het
Fndc3a T C 14: 72,556,585 K883E probably benign Het
Glyr1 A T 16: 5,018,992 M436K probably benign Het
Gm525 A T 11: 89,075,046 Q38L probably benign Het
Gnas T A 2: 174,345,247 V941D probably damaging Het
Hectd4 G C 5: 121,348,619 E3226Q possibly damaging Het
Ints13 G A 6: 146,550,106 R714C probably benign Het
Kif12 A T 4: 63,170,518 W182R probably damaging Het
Kif21a A G 15: 90,951,345 L1272P probably damaging Het
Klhl14 A C 18: 21,554,734 Y544D probably damaging Het
Kntc1 T C 5: 123,807,309 probably null Het
Lama1 G A 17: 67,738,787 R229Q possibly damaging Het
Ltbp1 T A 17: 75,273,949 probably null Het
Map4k5 A T 12: 69,824,655 C498S probably damaging Het
Myh9 A T 15: 77,771,162 V1198E probably benign Het
Ncoa6 T C 2: 155,411,608 D950G probably damaging Het
Obsl1 G T 1: 75,493,055 A1106D probably damaging Het
Olfr1034 T A 2: 86,046,566 V28E possibly damaging Het
Otog T A 7: 46,241,121 probably null Het
Oxtr A T 6: 112,477,261 I14N probably damaging Het
Pfkfb3 A T 2: 11,480,330 S490R probably damaging Het
Polk A C 13: 96,484,252 M560R probably benign Het
Polq C T 16: 37,086,681 H2335Y probably benign Het
Prr14 T A 7: 127,475,553 V419D possibly damaging Het
Rflnb A G 11: 76,022,166 V132A probably damaging Het
Rxfp1 T G 3: 79,661,320 I283L possibly damaging Het
Ryr3 G A 2: 112,841,975 R1384C probably damaging Het
Scnn1g T A 7: 121,738,215 C100S probably damaging Het
Sfrp2 G C 3: 83,766,626 G29R possibly damaging Het
Spop A G 11: 95,490,382 H312R probably damaging Het
Tpx2 A G 2: 152,885,231 probably null Het
Wdr4 A T 17: 31,499,089 V337E probably damaging Het
Zbtb11 A G 16: 56,007,029 N953D probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Olfr1065
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03133:Olfr1065 APN 2 86445658 missense probably damaging 0.99
IGL03173:Olfr1065 APN 2 86445444 nonsense probably null
IGL03257:Olfr1065 APN 2 86445890 missense probably damaging 0.98
D4043:Olfr1065 UTSW 2 86445220 missense probably damaging 0.99
R0265:Olfr1065 UTSW 2 86445959 missense probably benign 0.00
R0550:Olfr1065 UTSW 2 86445876 nonsense probably null
R0633:Olfr1065 UTSW 2 86445129 missense probably benign 0.45
R0727:Olfr1065 UTSW 2 86445938 missense probably benign 0.00
R1017:Olfr1065 UTSW 2 86445428 missense probably benign 0.13
R1416:Olfr1065 UTSW 2 86445320 missense probably benign 0.43
R1657:Olfr1065 UTSW 2 86445218 missense probably damaging 1.00
R1983:Olfr1065 UTSW 2 86445076 missense probably benign 0.01
R3919:Olfr1065 UTSW 2 86445418 missense probably benign 0.01
R4345:Olfr1065 UTSW 2 86445845 missense probably damaging 1.00
R5382:Olfr1065 UTSW 2 86445316 missense probably damaging 0.99
R6530:Olfr1065 UTSW 2 86445482 missense probably benign 0.31
R6765:Olfr1065 UTSW 2 86445236 missense probably benign 0.04
R6856:Olfr1065 UTSW 2 86445907 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCTTGTGTATTTGAGCAGACCAAAG -3'
(R):5'- TTACAATGGTGGACTCCAGGC -3'

Sequencing Primer
(F):5'- GTGTATTTGAGCAGACCAAAGATAAC -3'
(R):5'- GGTTATTCAACAACTGTGGGACCC -3'
Posted On2016-11-21