Incidental Mutation 'R5757:Scnn1g'
ID445101
Institutional Source Beutler Lab
Gene Symbol Scnn1g
Ensembl Gene ENSMUSG00000000216
Gene Namesodium channel, nonvoltage-gated 1 gamma
SynonymsENaC gamma
MMRRC Submission 043360-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.494) question?
Stock #R5757 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location121734479-121768475 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121738215 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 100 (C100S)
Ref Sequence ENSEMBL: ENSMUSP00000000221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000221]
Predicted Effect probably damaging
Transcript: ENSMUST00000000221
AA Change: C100S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000221
Gene: ENSMUSG00000000216
AA Change: C100S

DomainStartEndE-ValueType
Pfam:ASC 32 558 6.4e-91 PFAM
low complexity region 618 631 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the gamma subunit of the epithelial sodium channel, a member of the amiloride-sensitive sodium channel family of proteins. This channel regulates sodium homeostasis and blood pressure, by controlling sodium transport in the kidney, colon and lung. Proteolytic processing of the encoded protein results in the release of an inhibitory peptide and channel activation. Homozygous knockout mice for this gene exhibit perinatal lethality, likely due to excess serum potassium. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in partial lethality between 24-36 hours after birth. Newborns exhibit hyperkalemia, clear lung liquid more slowly, and show low urinary potassium and high urinary sodium concentrations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a C T 11: 110,042,968 A1204T probably benign Het
Adcy5 G T 16: 35,272,081 R604L probably damaging Het
Ago4 A T 4: 126,526,084 N33K probably damaging Het
Arid5b T C 10: 68,102,079 Y406C probably damaging Het
Asgr1 A C 11: 70,054,952 H18P probably benign Het
Asph A C 4: 9,637,722 probably null Het
Brd4 G A 17: 32,201,298 probably benign Het
Ccdc150 T A 1: 54,263,620 I133N probably damaging Het
Cdon A C 9: 35,452,772 H62P probably damaging Het
Clec4b1 T A 6: 123,069,754 Y157* probably null Het
Clip1 G A 5: 123,627,397 T810I probably benign Het
Crocc A T 4: 141,043,564 L184Q probably damaging Het
Fat2 C T 11: 55,252,346 G4226R probably damaging Het
Fbxo30 T A 10: 11,290,421 C296S probably benign Het
Fndc3a T C 14: 72,556,585 K883E probably benign Het
Glyr1 A T 16: 5,018,992 M436K probably benign Het
Gm525 A T 11: 89,075,046 Q38L probably benign Het
Gnas T A 2: 174,345,247 V941D probably damaging Het
Hectd4 G C 5: 121,348,619 E3226Q possibly damaging Het
Ints13 G A 6: 146,550,106 R714C probably benign Het
Kif12 A T 4: 63,170,518 W182R probably damaging Het
Kif21a A G 15: 90,951,345 L1272P probably damaging Het
Klhl14 A C 18: 21,554,734 Y544D probably damaging Het
Kntc1 T C 5: 123,807,309 probably null Het
Lama1 G A 17: 67,738,787 R229Q possibly damaging Het
Ltbp1 T A 17: 75,273,949 probably null Het
Map4k5 A T 12: 69,824,655 C498S probably damaging Het
Myh9 A T 15: 77,771,162 V1198E probably benign Het
Ncoa6 T C 2: 155,411,608 D950G probably damaging Het
Obsl1 G T 1: 75,493,055 A1106D probably damaging Het
Olfr1034 T A 2: 86,046,566 V28E possibly damaging Het
Olfr1065 T C 2: 86,445,578 I135V probably benign Het
Otog T A 7: 46,241,121 probably null Het
Oxtr A T 6: 112,477,261 I14N probably damaging Het
Pfkfb3 A T 2: 11,480,330 S490R probably damaging Het
Polk A C 13: 96,484,252 M560R probably benign Het
Polq C T 16: 37,086,681 H2335Y probably benign Het
Prr14 T A 7: 127,475,553 V419D possibly damaging Het
Rflnb A G 11: 76,022,166 V132A probably damaging Het
Rxfp1 T G 3: 79,661,320 I283L possibly damaging Het
Ryr3 G A 2: 112,841,975 R1384C probably damaging Het
Sfrp2 G C 3: 83,766,626 G29R possibly damaging Het
Spop A G 11: 95,490,382 H312R probably damaging Het
Tpx2 A G 2: 152,885,231 probably null Het
Wdr4 A T 17: 31,499,089 V337E probably damaging Het
Zbtb11 A G 16: 56,007,029 N953D probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Scnn1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Scnn1g APN 7 121740437 missense probably benign 0.00
IGL01824:Scnn1g APN 7 121766293 missense probably benign 0.00
IGL02133:Scnn1g APN 7 121743699 missense probably damaging 1.00
IGL02529:Scnn1g APN 7 121742446 splice site probably benign
IGL02814:Scnn1g APN 7 121740365 missense probably damaging 1.00
IGL03091:Scnn1g APN 7 121746683 missense probably damaging 1.00
IGL03253:Scnn1g APN 7 121737933 nonsense probably null
PIT4504001:Scnn1g UTSW 7 121742331 missense probably benign 0.30
R0230:Scnn1g UTSW 7 121746761 splice site probably benign
R0324:Scnn1g UTSW 7 121740555 missense possibly damaging 0.62
R0367:Scnn1g UTSW 7 121746579 splice site probably benign
R0534:Scnn1g UTSW 7 121767424 missense probably benign 0.00
R1747:Scnn1g UTSW 7 121760463 missense probably damaging 0.99
R2004:Scnn1g UTSW 7 121738188 nonsense probably null
R2197:Scnn1g UTSW 7 121767296 missense probably damaging 1.00
R4396:Scnn1g UTSW 7 121740427 missense probably benign 0.01
R4804:Scnn1g UTSW 7 121763080 frame shift probably null
R4805:Scnn1g UTSW 7 121746602 missense probably damaging 1.00
R5219:Scnn1g UTSW 7 121766266 missense probably damaging 1.00
R5882:Scnn1g UTSW 7 121767358 missense possibly damaging 0.79
R5910:Scnn1g UTSW 7 121738095 missense probably damaging 0.99
R6381:Scnn1g UTSW 7 121767499 missense probably benign 0.00
R6666:Scnn1g UTSW 7 121767388 missense probably benign 0.00
R6735:Scnn1g UTSW 7 121742263 missense probably benign 0.02
R6813:Scnn1g UTSW 7 121740353 missense probably damaging 1.00
R6860:Scnn1g UTSW 7 121740353 missense probably damaging 1.00
R6887:Scnn1g UTSW 7 121760444 missense probably benign 0.01
R7289:Scnn1g UTSW 7 121738081 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACCTGATGCATTGGTACTGC -3'
(R):5'- TGAAAACATGCAGGTCTGAAATCG -3'

Sequencing Primer
(F):5'- GATGCATTGGTACTGCCTGAACAC -3'
(R):5'- CTGAAATCGATCTTGGCGATC -3'
Posted On2016-11-21