Incidental Mutation 'R5757:Glyr1'
ID445117
Institutional Source Beutler Lab
Gene Symbol Glyr1
Ensembl Gene ENSMUSG00000022536
Gene Nameglyoxylate reductase 1 homolog (Arabidopsis)
Synonyms3930401K13Rik, Npac, 2810419J22Rik
MMRRC Submission 043360-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R5757 (G1)
Quality Score190
Status Not validated
Chromosome16
Chromosomal Location5013909-5049863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5018992 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 436 (M436K)
Ref Sequence ENSEMBL: ENSMUSP00000111510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023189] [ENSMUST00000115844]
Predicted Effect probably benign
Transcript: ENSMUST00000023189
AA Change: M430K

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000023189
Gene: ENSMUSG00000022536
AA Change: M430K

DomainStartEndE-ValueType
Pfam:PWWP 6 89 1.4e-24 PFAM
low complexity region 109 122 N/A INTRINSIC
AT_hook 167 179 3.21e-1 SMART
Pfam:NAD_binding_2 266 422 1.2e-36 PFAM
Pfam:F420_oxidored 268 355 2e-6 PFAM
Pfam:NAD_binding_11 423 544 2.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115844
AA Change: M436K

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000111510
Gene: ENSMUSG00000022536
AA Change: M436K

DomainStartEndE-ValueType
Pfam:PWWP 6 89 1.8e-24 PFAM
low complexity region 109 122 N/A INTRINSIC
AT_hook 167 179 3.21e-1 SMART
Pfam:NAD_binding_2 266 428 2.6e-41 PFAM
Pfam:F420_oxidored 268 361 3.2e-9 PFAM
Pfam:NAD_binding_11 429 550 3.4e-25 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a C T 11: 110,042,968 A1204T probably benign Het
Adcy5 G T 16: 35,272,081 R604L probably damaging Het
Ago4 A T 4: 126,526,084 N33K probably damaging Het
Arid5b T C 10: 68,102,079 Y406C probably damaging Het
Asgr1 A C 11: 70,054,952 H18P probably benign Het
Asph A C 4: 9,637,722 probably null Het
Brd4 G A 17: 32,201,298 probably benign Het
Ccdc150 T A 1: 54,263,620 I133N probably damaging Het
Cdon A C 9: 35,452,772 H62P probably damaging Het
Clec4b1 T A 6: 123,069,754 Y157* probably null Het
Clip1 G A 5: 123,627,397 T810I probably benign Het
Crocc A T 4: 141,043,564 L184Q probably damaging Het
Fat2 C T 11: 55,252,346 G4226R probably damaging Het
Fbxo30 T A 10: 11,290,421 C296S probably benign Het
Fndc3a T C 14: 72,556,585 K883E probably benign Het
Gm525 A T 11: 89,075,046 Q38L probably benign Het
Gnas T A 2: 174,345,247 V941D probably damaging Het
Hectd4 G C 5: 121,348,619 E3226Q possibly damaging Het
Ints13 G A 6: 146,550,106 R714C probably benign Het
Kif12 A T 4: 63,170,518 W182R probably damaging Het
Kif21a A G 15: 90,951,345 L1272P probably damaging Het
Klhl14 A C 18: 21,554,734 Y544D probably damaging Het
Kntc1 T C 5: 123,807,309 probably null Het
Lama1 G A 17: 67,738,787 R229Q possibly damaging Het
Ltbp1 T A 17: 75,273,949 probably null Het
Map4k5 A T 12: 69,824,655 C498S probably damaging Het
Myh9 A T 15: 77,771,162 V1198E probably benign Het
Ncoa6 T C 2: 155,411,608 D950G probably damaging Het
Obsl1 G T 1: 75,493,055 A1106D probably damaging Het
Olfr1034 T A 2: 86,046,566 V28E possibly damaging Het
Olfr1065 T C 2: 86,445,578 I135V probably benign Het
Otog T A 7: 46,241,121 probably null Het
Oxtr A T 6: 112,477,261 I14N probably damaging Het
Pfkfb3 A T 2: 11,480,330 S490R probably damaging Het
Polk A C 13: 96,484,252 M560R probably benign Het
Polq C T 16: 37,086,681 H2335Y probably benign Het
Prr14 T A 7: 127,475,553 V419D possibly damaging Het
Rflnb A G 11: 76,022,166 V132A probably damaging Het
Rxfp1 T G 3: 79,661,320 I283L possibly damaging Het
Ryr3 G A 2: 112,841,975 R1384C probably damaging Het
Scnn1g T A 7: 121,738,215 C100S probably damaging Het
Sfrp2 G C 3: 83,766,626 G29R possibly damaging Het
Spop A G 11: 95,490,382 H312R probably damaging Het
Tpx2 A G 2: 152,885,231 probably null Het
Wdr4 A T 17: 31,499,089 V337E probably damaging Het
Zbtb11 A G 16: 56,007,029 N953D probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Glyr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Glyr1 APN 16 5020288 missense probably benign
IGL02332:Glyr1 APN 16 5018953 missense probably damaging 1.00
IGL02407:Glyr1 APN 16 5036948 missense probably benign 0.01
IGL02429:Glyr1 APN 16 5019376 missense probably benign 0.28
IGL03255:Glyr1 APN 16 5048757 unclassified probably null
R0020:Glyr1 UTSW 16 5037049 missense probably damaging 1.00
R0309:Glyr1 UTSW 16 5031972 missense probably damaging 0.98
R0694:Glyr1 UTSW 16 5026560 missense probably damaging 0.99
R0971:Glyr1 UTSW 16 5021345 frame shift probably null
R1347:Glyr1 UTSW 16 5021339 missense probably damaging 1.00
R1347:Glyr1 UTSW 16 5021339 missense probably damaging 1.00
R1382:Glyr1 UTSW 16 5021345 frame shift probably null
R1383:Glyr1 UTSW 16 5021345 frame shift probably null
R2137:Glyr1 UTSW 16 5018482 missense probably benign 0.01
R2254:Glyr1 UTSW 16 5019013 missense probably benign 0.01
R3913:Glyr1 UTSW 16 5031913 missense probably damaging 1.00
R4112:Glyr1 UTSW 16 5018486 missense possibly damaging 0.83
R4629:Glyr1 UTSW 16 5037043 missense possibly damaging 0.70
R4795:Glyr1 UTSW 16 5047758 missense probably benign 0.40
R5112:Glyr1 UTSW 16 5018876 nonsense probably null
R5412:Glyr1 UTSW 16 5036433 missense possibly damaging 0.87
R6425:Glyr1 UTSW 16 5036486 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTTTCCTGGATGGTCTGACC -3'
(R):5'- TTTGCCAGACACAATTAGTACCTGG -3'

Sequencing Primer
(F):5'- TGGATGGTCTGACCCAGCTG -3'
(R):5'- GAAGGAAAAAGAGCCAGTCCTGTC -3'
Posted On2016-11-21