Incidental Mutation 'R5757:Wdr4'
ID445120
Institutional Source Beutler Lab
Gene Symbol Wdr4
Ensembl Gene ENSMUSG00000024037
Gene NameWD repeat domain 4
SynonymsD530049K22Rik
MMRRC Submission 043360-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.891) question?
Stock #R5757 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location31494323-31519974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31499089 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 337 (V337E)
Ref Sequence ENSEMBL: ENSMUSP00000126061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167419] [ENSMUST00000171171] [ENSMUST00000171291]
Predicted Effect probably benign
Transcript: ENSMUST00000166626
SMART Domains Protein: ENSMUSP00000125954
Gene: ENSMUSG00000024037

DomainStartEndE-ValueType
SCOP:d1kb0a2 18 93 1e-2 SMART
Blast:WD40 39 91 1e-30 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166992
Predicted Effect probably benign
Transcript: ENSMUST00000167419
SMART Domains Protein: ENSMUSP00000127617
Gene: ENSMUSG00000024037

DomainStartEndE-ValueType
SCOP:d1e1aa_ 71 143 5e-4 SMART
Blast:WD40 74 134 2e-36 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169224
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169454
Predicted Effect probably benign
Transcript: ENSMUST00000170176
SMART Domains Protein: ENSMUSP00000127073
Gene: ENSMUSG00000024037

DomainStartEndE-ValueType
SCOP:d1e1aa_ 33 105 9e-4 SMART
Blast:WD40 36 96 8e-37 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000171171
AA Change: V337E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126061
Gene: ENSMUSG00000024037
AA Change: V337E

DomainStartEndE-ValueType
WD40 74 134 1.58e2 SMART
WD40 137 175 2.37e2 SMART
WD40 178 218 4.44e0 SMART
WD40 222 262 3.5e-4 SMART
low complexity region 417 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171291
Predicted Effect probably benign
Transcript: ENSMUST00000172284
SMART Domains Protein: ENSMUSP00000129736
Gene: ENSMUSG00000024037

DomainStartEndE-ValueType
Blast:WD40 36 88 2e-30 BLAST
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is excluded as a candidate for a form of nonsyndromic deafness (DFNB10), but is still a candidate for other disorders mapped to 21q22.3 as well as for the development of Down syndrome phenotypes. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a null allele display lethality during organogenesis with increased apoptosis and DNA damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a C T 11: 110,042,968 A1204T probably benign Het
Adcy5 G T 16: 35,272,081 R604L probably damaging Het
Ago4 A T 4: 126,526,084 N33K probably damaging Het
Arid5b T C 10: 68,102,079 Y406C probably damaging Het
Asgr1 A C 11: 70,054,952 H18P probably benign Het
Asph A C 4: 9,637,722 probably null Het
Brd4 G A 17: 32,201,298 probably benign Het
Ccdc150 T A 1: 54,263,620 I133N probably damaging Het
Cdon A C 9: 35,452,772 H62P probably damaging Het
Clec4b1 T A 6: 123,069,754 Y157* probably null Het
Clip1 G A 5: 123,627,397 T810I probably benign Het
Crocc A T 4: 141,043,564 L184Q probably damaging Het
Fat2 C T 11: 55,252,346 G4226R probably damaging Het
Fbxo30 T A 10: 11,290,421 C296S probably benign Het
Fndc3a T C 14: 72,556,585 K883E probably benign Het
Glyr1 A T 16: 5,018,992 M436K probably benign Het
Gm525 A T 11: 89,075,046 Q38L probably benign Het
Gnas T A 2: 174,345,247 V941D probably damaging Het
Hectd4 G C 5: 121,348,619 E3226Q possibly damaging Het
Ints13 G A 6: 146,550,106 R714C probably benign Het
Kif12 A T 4: 63,170,518 W182R probably damaging Het
Kif21a A G 15: 90,951,345 L1272P probably damaging Het
Klhl14 A C 18: 21,554,734 Y544D probably damaging Het
Kntc1 T C 5: 123,807,309 probably null Het
Lama1 G A 17: 67,738,787 R229Q possibly damaging Het
Ltbp1 T A 17: 75,273,949 probably null Het
Map4k5 A T 12: 69,824,655 C498S probably damaging Het
Myh9 A T 15: 77,771,162 V1198E probably benign Het
Ncoa6 T C 2: 155,411,608 D950G probably damaging Het
Obsl1 G T 1: 75,493,055 A1106D probably damaging Het
Olfr1034 T A 2: 86,046,566 V28E possibly damaging Het
Olfr1065 T C 2: 86,445,578 I135V probably benign Het
Otog T A 7: 46,241,121 probably null Het
Oxtr A T 6: 112,477,261 I14N probably damaging Het
Pfkfb3 A T 2: 11,480,330 S490R probably damaging Het
Polk A C 13: 96,484,252 M560R probably benign Het
Polq C T 16: 37,086,681 H2335Y probably benign Het
Prr14 T A 7: 127,475,553 V419D possibly damaging Het
Rflnb A G 11: 76,022,166 V132A probably damaging Het
Rxfp1 T G 3: 79,661,320 I283L possibly damaging Het
Ryr3 G A 2: 112,841,975 R1384C probably damaging Het
Scnn1g T A 7: 121,738,215 C100S probably damaging Het
Sfrp2 G C 3: 83,766,626 G29R possibly damaging Het
Spop A G 11: 95,490,382 H312R probably damaging Het
Tpx2 A G 2: 152,885,231 probably null Het
Zbtb11 A G 16: 56,007,029 N953D probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Wdr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Wdr4 APN 17 31501258 missense possibly damaging 0.94
IGL03158:Wdr4 APN 17 31499128 missense probably benign 0.00
R0091:Wdr4 UTSW 17 31496916 missense probably benign 0.01
R1524:Wdr4 UTSW 17 31509763 intron probably benign
R2009:Wdr4 UTSW 17 31500610 splice site probably benign
R3822:Wdr4 UTSW 17 31512221 missense probably damaging 0.99
R4334:Wdr4 UTSW 17 31499152 missense possibly damaging 0.70
R4786:Wdr4 UTSW 17 31509811 missense probably damaging 1.00
R4873:Wdr4 UTSW 17 31499155 missense probably benign 0.05
R4875:Wdr4 UTSW 17 31499155 missense probably benign 0.05
R5117:Wdr4 UTSW 17 31499824 missense probably benign 0.00
R5372:Wdr4 UTSW 17 31510580 missense probably damaging 1.00
R6024:Wdr4 UTSW 17 31501298 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGGATGTGAACAAGGCTGTG -3'
(R):5'- AACATGTACCATCTCCCAGGGTC -3'

Sequencing Primer
(F):5'- AACAAGGCTGTGGGGAAACC -3'
(R):5'- GCTCAGGGTCTGCAGGTAGTATAG -3'
Posted On2016-11-21