Incidental Mutation 'R5759:Piezo1'
ID445191
Institutional Source Beutler Lab
Gene Symbol Piezo1
Ensembl Gene ENSMUSG00000014444
Gene Namepiezo-type mechanosensitive ion channel component 1
SynonymsFam38a, Piezo1
MMRRC Submission 043361-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5759 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location122481698-122551329 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122507655 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 84 (V84A)
Ref Sequence ENSEMBL: ENSMUSP00000114584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067252] [ENSMUST00000127664] [ENSMUST00000156333]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067252
AA Change: V84A

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000089777
Gene: ENSMUSG00000014444
AA Change: V84A

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
low complexity region 156 169 N/A INTRINSIC
transmembrane domain 211 233 N/A INTRINSIC
transmembrane domain 248 270 N/A INTRINSIC
transmembrane domain 316 333 N/A INTRINSIC
low complexity region 353 368 N/A INTRINSIC
low complexity region 396 408 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
transmembrane domain 513 535 N/A INTRINSIC
internal_repeat_1 541 658 5.31e-5 PROSPERO
transmembrane domain 685 707 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
transmembrane domain 817 839 N/A INTRINSIC
transmembrane domain 844 866 N/A INTRINSIC
low complexity region 940 952 N/A INTRINSIC
transmembrane domain 979 1001 N/A INTRINSIC
transmembrane domain 1005 1022 N/A INTRINSIC
transmembrane domain 1035 1057 N/A INTRINSIC
transmembrane domain 1154 1171 N/A INTRINSIC
transmembrane domain 1178 1197 N/A INTRINSIC
Pfam:PIEZO 1229 1458 1.1e-97 PFAM
low complexity region 1475 1486 N/A INTRINSIC
internal_repeat_1 1646 1752 5.31e-5 PROSPERO
low complexity region 1905 1921 N/A INTRINSIC
transmembrane domain 1976 1998 N/A INTRINSIC
transmembrane domain 2018 2038 N/A INTRINSIC
transmembrane domain 2045 2067 N/A INTRINSIC
transmembrane domain 2077 2094 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2126 2544 3.2e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000156333
AA Change: V84A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114584
Gene: ENSMUSG00000014444
AA Change: V84A

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
transmembrane domain 212 234 N/A INTRINSIC
transmembrane domain 249 271 N/A INTRINSIC
transmembrane domain 317 334 N/A INTRINSIC
low complexity region 354 369 N/A INTRINSIC
low complexity region 397 409 N/A INTRINSIC
transmembrane domain 434 456 N/A INTRINSIC
transmembrane domain 469 491 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
internal_repeat_1 542 659 4.88e-5 PROSPERO
transmembrane domain 686 708 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
transmembrane domain 845 867 N/A INTRINSIC
low complexity region 941 953 N/A INTRINSIC
transmembrane domain 980 1002 N/A INTRINSIC
transmembrane domain 1006 1023 N/A INTRINSIC
transmembrane domain 1036 1058 N/A INTRINSIC
transmembrane domain 1155 1172 N/A INTRINSIC
transmembrane domain 1179 1198 N/A INTRINSIC
Pfam:PIEZO 1230 1459 2.3e-94 PFAM
low complexity region 1476 1487 N/A INTRINSIC
internal_repeat_1 1647 1753 4.88e-5 PROSPERO
low complexity region 1906 1922 N/A INTRINSIC
transmembrane domain 1977 1999 N/A INTRINSIC
transmembrane domain 2019 2039 N/A INTRINSIC
transmembrane domain 2046 2068 N/A INTRINSIC
transmembrane domain 2078 2095 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2127 2545 8.7e-154 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mechanically-activated ion channel that links mechanical forces to biological signals. The encoded protein contains 36 transmembrane domains and functions as a homotetramer. Defects in this gene have been associated with dehydrated hereditary stomatocytosis. [provided by RefSeq, Jul 2015]
PHENOTYPE: Most mice homozygous for a gene trapped allele die at midgestation, exhibiting embryonic growth retardation, pericardial effusion, and vascular remodeling defects in the yolk sac and the embryo proper. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,068,658 S1203P probably benign Het
Adamts1 A G 16: 85,798,048 V341A possibly damaging Het
AF529169 A T 9: 89,601,072 N757K probably benign Het
Arf2 G A 11: 103,983,633 G144S probably benign Het
Atr A G 9: 95,874,402 N862D probably benign Het
Cep295nl T C 11: 118,333,646 H124R possibly damaging Het
Chd6 C T 2: 160,983,762 V1141I possibly damaging Het
Chst5 C A 8: 111,890,210 K259N probably benign Het
Dchs1 T A 7: 105,764,176 D1144V probably damaging Het
Dmxl2 T C 9: 54,375,508 Y2795C probably damaging Het
Dnah7b A G 1: 46,277,120 N3131S probably damaging Het
Dnah7c G A 1: 46,615,367 G1436R probably damaging Het
Emp2 T A 16: 10,284,510 Y146F probably damaging Het
Exoc6 C T 19: 37,573,741 Q148* probably null Het
Fam13b T C 18: 34,497,435 D90G probably damaging Het
Fam186b T G 15: 99,279,717 Y576S probably benign Het
Fras1 T C 5: 96,709,916 V2023A probably benign Het
Gm14409 A T 2: 177,264,972 C244* probably null Het
Grm5 A C 7: 88,026,600 M441L probably damaging Het
Hhatl A G 9: 121,788,277 Y297H probably damaging Het
Ifi30 A G 8: 70,766,544 probably benign Het
Ing2 G T 8: 47,669,005 N169K possibly damaging Het
Kat6a T G 8: 22,938,012 S1128A probably benign Het
Madd T C 2: 91,162,075 E1041G possibly damaging Het
Mcm3 CT CTT 1: 20,808,748 probably null Het
Mfsd5 G A 15: 102,281,078 G295D possibly damaging Het
Mmp20 T A 9: 7,628,377 probably null Het
Mybphl T C 3: 108,374,754 V100A probably benign Het
Ndfip2 T A 14: 105,302,316 probably null Het
Olfr862 A G 9: 19,884,188 V39A probably benign Het
Olfr869 T A 9: 20,137,932 V272E probably benign Het
Olfr905 T A 9: 38,473,535 S263T possibly damaging Het
Phf19 T G 2: 34,897,123 D443A probably damaging Het
Sept9 A G 11: 117,352,268 I94V probably benign Het
Slc35a1 C A 4: 34,675,032 V132L probably benign Het
Sntg1 G A 1: 8,414,270 S442L probably benign Het
Tcf25 A G 8: 123,381,457 T84A probably benign Het
Tchhl1 C G 3: 93,471,556 S522R probably damaging Het
Tmem106b A G 6: 13,075,042 E76G probably damaging Het
Tnk2 C T 16: 32,680,664 P932S probably benign Het
Trib1 G A 15: 59,654,501 V307I probably benign Het
Trib3 A T 2: 152,343,295 D11E probably benign Het
Trim34b T C 7: 104,331,433 S243P possibly damaging Het
Vmn2r50 A G 7: 10,047,978 I280T probably damaging Het
Zfp445 G T 9: 122,853,146 Q577K probably benign Het
Zfp599 T C 9: 22,249,661 K403E probably damaging Het
Other mutations in Piezo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Piezo1 APN 8 122497870 missense possibly damaging 0.91
IGL01094:Piezo1 APN 8 122482138 missense probably damaging 0.99
IGL01321:Piezo1 APN 8 122487600 missense probably damaging 0.99
IGL01695:Piezo1 APN 8 122495509 missense possibly damaging 0.81
IGL01762:Piezo1 APN 8 122487929 nonsense probably null
IGL01922:Piezo1 APN 8 122492692 missense probably benign 0.41
IGL01953:Piezo1 APN 8 122491184 missense probably damaging 1.00
IGL01997:Piezo1 APN 8 122488331 splice site probably benign
IGL02381:Piezo1 APN 8 122498544 missense probably benign 0.28
IGL02398:Piezo1 APN 8 122486563 missense probably benign 0.21
IGL02562:Piezo1 APN 8 122496763 missense probably benign 0.11
IGL02572:Piezo1 APN 8 122485305 missense probably benign 0.28
IGL02691:Piezo1 APN 8 122501949 missense possibly damaging 0.58
IGL02726:Piezo1 APN 8 122487155 missense probably damaging 0.99
IGL02814:Piezo1 APN 8 122498215 missense probably damaging 1.00
IGL02931:Piezo1 APN 8 122483519 missense probably damaging 1.00
IGL03145:Piezo1 APN 8 122482921 missense probably benign 0.14
FR4449:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
FR4548:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
FR4737:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
FR4976:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
LCD18:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
R0085:Piezo1 UTSW 8 122501615 missense probably damaging 0.98
R0096:Piezo1 UTSW 8 122485370 unclassified probably benign
R0970:Piezo1 UTSW 8 122486810 missense possibly damaging 0.94
R1364:Piezo1 UTSW 8 122498571 missense possibly damaging 0.61
R1460:Piezo1 UTSW 8 122502151 missense possibly damaging 0.86
R1485:Piezo1 UTSW 8 122482049 missense probably damaging 1.00
R1538:Piezo1 UTSW 8 122491403 missense probably damaging 1.00
R1655:Piezo1 UTSW 8 122496822 missense probably benign 0.09
R1700:Piezo1 UTSW 8 122487502 missense probably damaging 1.00
R1860:Piezo1 UTSW 8 122495750 missense possibly damaging 0.90
R1861:Piezo1 UTSW 8 122495750 missense possibly damaging 0.90
R1899:Piezo1 UTSW 8 122482645 unclassified probably benign
R1899:Piezo1 UTSW 8 122489566 missense probably damaging 1.00
R1900:Piezo1 UTSW 8 122482645 unclassified probably benign
R2018:Piezo1 UTSW 8 122482712 missense probably benign 0.43
R2019:Piezo1 UTSW 8 122482712 missense probably benign 0.43
R2219:Piezo1 UTSW 8 122491488 missense probably benign 0.01
R2331:Piezo1 UTSW 8 122487266 unclassified probably null
R3016:Piezo1 UTSW 8 122506027 critical splice donor site probably null
R3699:Piezo1 UTSW 8 122494903 missense probably damaging 1.00
R3700:Piezo1 UTSW 8 122494903 missense probably damaging 1.00
R3746:Piezo1 UTSW 8 122492638 missense probably damaging 1.00
R3905:Piezo1 UTSW 8 122482143 missense probably damaging 1.00
R4093:Piezo1 UTSW 8 122501160 critical splice donor site probably null
R4296:Piezo1 UTSW 8 122491127 missense probably damaging 1.00
R4396:Piezo1 UTSW 8 122498674 missense probably damaging 0.98
R4467:Piezo1 UTSW 8 122486396 missense probably benign 0.17
R4614:Piezo1 UTSW 8 122486411 missense probably benign 0.25
R4642:Piezo1 UTSW 8 122495454 missense probably damaging 1.00
R4688:Piezo1 UTSW 8 122488539 missense probably damaging 1.00
R4734:Piezo1 UTSW 8 122498206 missense probably damaging 1.00
R4749:Piezo1 UTSW 8 122486939 missense possibly damaging 0.48
R4749:Piezo1 UTSW 8 122498206 missense probably damaging 1.00
R4865:Piezo1 UTSW 8 122486921 missense probably damaging 1.00
R4869:Piezo1 UTSW 8 122487545 missense probably benign
R4962:Piezo1 UTSW 8 122486481 missense probably benign 0.41
R5026:Piezo1 UTSW 8 122486818 missense probably benign 0.11
R5418:Piezo1 UTSW 8 122486780 missense probably damaging 1.00
R5625:Piezo1 UTSW 8 122482960 missense probably benign 0.01
R5864:Piezo1 UTSW 8 122486373 missense possibly damaging 0.75
R5898:Piezo1 UTSW 8 122487943 missense probably benign 0.00
R5948:Piezo1 UTSW 8 122483347 missense probably benign 0.01
R6052:Piezo1 UTSW 8 122506269 missense probably damaging 1.00
R6086:Piezo1 UTSW 8 122501657 missense possibly damaging 0.73
R6216:Piezo1 UTSW 8 122489130 missense probably benign 0.05
R6271:Piezo1 UTSW 8 122494932 missense probably damaging 1.00
R6549:Piezo1 UTSW 8 122500263 missense probably benign 0.02
R6723:Piezo1 UTSW 8 122507627 missense probably benign 0.15
R6871:Piezo1 UTSW 8 122485027 unclassified probably null
R6919:Piezo1 UTSW 8 122490281 missense probably damaging 1.00
R7085:Piezo1 UTSW 8 122490894 missense
R7105:Piezo1 UTSW 8 122482118 missense unknown
R7267:Piezo1 UTSW 8 122497529 missense
Predicted Primers PCR Primer
(F):5'- AATGGCCTGGCTCTGCTGA -3'
(R):5'- GATTCCTCACAGCCAGTCCC -3'

Sequencing Primer
(F):5'- CTCTGCTGACCTGGCAC -3'
(R):5'- CACTGAGTGTGTATCTCAGGCAC -3'
Posted On2016-11-21