Incidental Mutation 'R5760:Nsd3'
ID445244
Institutional Source Beutler Lab
Gene Symbol Nsd3
Ensembl Gene ENSMUSG00000054823
Gene Namenuclear receptor binding SET domain protein 3
SynonymsWhsc1l1, WHISTLE
MMRRC Submission 043362-MU
Accession Numbers

Genbank: NM_001081269, NM_001001735.1; MGI: 2142581; Ensemb: ENSMUST00000155861, ENSMUST00000146919, ENSMUST00000142395, ENSMUST00000139966, ENSMUST00000153597, ENSMUST00000084026, ENSMUST0000017135

Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R5760 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location25601601-25719667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25659756 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 319 (H319L)
Ref Sequence ENSEMBL: ENSMUSP00000117778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084026] [ENSMUST00000136107] [ENSMUST00000139966] [ENSMUST00000142395] [ENSMUST00000143445] [ENSMUST00000146919] [ENSMUST00000155861]
Predicted Effect probably damaging
Transcript: ENSMUST00000084026
AA Change: H319L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081040
Gene: ENSMUSG00000054823
AA Change: H319L

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 963 1e-4 SMART
PWWP 968 1030 8.62e-18 SMART
AWS 1103 1154 2.61e-17 SMART
SET 1155 1278 2.17e-41 SMART
PostSET 1279 1295 2.63e-3 SMART
low complexity region 1309 1326 N/A INTRINSIC
PHD 1332 1375 4.32e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000136107
AA Change: H319L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000139966
AA Change: H319L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122096
Gene: ENSMUSG00000054823
AA Change: H319L

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 914 5.24e-8 SMART
PWWP 919 981 8.62e-18 SMART
AWS 1054 1105 2.61e-17 SMART
SET 1106 1229 2.17e-41 SMART
PostSET 1230 1246 2.63e-3 SMART
low complexity region 1260 1277 N/A INTRINSIC
PHD 1283 1326 4.32e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000142395
AA Change: H319L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117778
Gene: ENSMUSG00000054823
AA Change: H319L

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 963 1e-4 SMART
PWWP 968 1030 8.62e-18 SMART
AWS 1103 1154 2.61e-17 SMART
SET 1155 1278 2.17e-41 SMART
PostSET 1279 1295 2.63e-3 SMART
low complexity region 1309 1326 N/A INTRINSIC
PHD 1332 1375 4.32e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143445
AA Change: H319L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000146919
AA Change: H319L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115470
Gene: ENSMUSG00000054823
AA Change: H319L

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
Pfam:PWWP 278 388 1.6e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155861
AA Change: H319L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117596
Gene: ENSMUSG00000054823
AA Change: H319L

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
Pfam:PWWP 278 388 1.6e-25 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the SET domain family of histone lysine N-methyltransferase proteins. This protein methylates histone H3 at lysine residues 4 and 27, which represses gene transcription. It acts in opposition to the histone demethylase Jmjd1c. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2015]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik T C 15: 37,439,591 probably benign Het
Abl2 C T 1: 156,641,857 T793M probably benign Het
Accs A C 2: 93,845,760 L90R probably damaging Het
Ahnak A T 19: 9,013,562 D4070V probably damaging Het
Apbb2 A G 5: 66,362,757 V475A probably benign Het
Atp10d T A 5: 72,260,937 V602E probably benign Het
Cdh23 C T 10: 60,406,392 V1088M probably damaging Het
Dennd6a A T 14: 26,612,040 I144L probably damaging Het
Dnajc6 G A 4: 101,618,642 A571T probably benign Het
Drap1 A G 19: 5,424,363 I18T probably damaging Het
En2 C A 5: 28,166,999 A158D probably benign Het
Fbn1 C T 2: 125,361,247 G1219R probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gm7535 C T 17: 17,911,818 probably benign Het
Hao2 A T 3: 98,880,432 L227* probably null Het
Hdlbp C T 1: 93,440,777 probably benign Het
Hivep3 A G 4: 120,095,011 K175E possibly damaging Het
Hmcn2 G A 2: 31,414,568 A3075T possibly damaging Het
Igkv6-15 A T 6: 70,406,532 I95N probably damaging Het
Itgad A T 7: 128,203,365 Q1001L probably benign Het
Jaml T A 9: 45,097,754 M151K probably benign Het
Lix1 T A 17: 17,427,237 V55D possibly damaging Het
Macf1 A G 4: 123,513,884 S179P probably damaging Het
Matn2 T A 15: 34,355,607 Q33L possibly damaging Het
Mcm3 CT CTT 1: 20,808,748 probably null Het
Mroh5 A C 15: 73,821,507 I28S probably damaging Het
Naip5 T G 13: 100,242,838 K231N probably damaging Het
Neb A C 2: 52,183,818 Y5683D probably damaging Het
Npc1l1 A T 11: 6,229,031 H126Q probably benign Het
Npm2 A G 14: 70,649,495 F110L probably damaging Het
Nup205 G A 6: 35,247,343 R2039Q probably damaging Het
Olfr1406 C A 1: 173,183,751 A228S probably benign Het
Olfr1415 A G 1: 92,491,200 L185P possibly damaging Het
Olfr77 A C 9: 19,920,754 T182P probably benign Het
Pcdhac2 G A 18: 37,146,400 G811E probably damaging Het
Pkhd1 T A 1: 20,073,554 R3849S probably benign Het
Pmfbp1 A T 8: 109,521,023 D317V probably damaging Het
Sall1 T C 8: 89,028,650 N1234D possibly damaging Het
Slc12a7 T A 13: 73,813,622 V1037D probably damaging Het
Slc12a8 G T 16: 33,624,785 E404* probably null Het
Tchhl1 C G 3: 93,471,556 S522R probably damaging Het
Tgif1 A G 17: 70,845,001 V152A probably damaging Het
Tshz3 C A 7: 36,771,569 H994Q probably damaging Het
Ubash3b T G 9: 41,077,423 K62T probably benign Het
Ushbp1 G T 8: 71,387,368 D546E probably damaging Het
Zfp458 A C 13: 67,257,789 C192W probably damaging Het
Zfp808 A T 13: 62,171,926 H323L probably damaging Het
Other mutations in Nsd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Nsd3 APN 8 25676712 missense probably benign 0.40
IGL00718:Nsd3 APN 8 25706534 missense probably damaging 0.97
IGL00727:Nsd3 APN 8 25641158 missense probably damaging 1.00
IGL01324:Nsd3 APN 8 25662820 missense probably damaging 1.00
IGL01614:Nsd3 APN 8 25666079 missense possibly damaging 0.65
IGL01834:Nsd3 APN 8 25640652 missense probably damaging 1.00
IGL02066:Nsd3 APN 8 25713488 missense probably damaging 1.00
IGL02229:Nsd3 APN 8 25710748 missense probably damaging 0.98
IGL02481:Nsd3 APN 8 25691116 missense probably damaging 1.00
IGL02686:Nsd3 APN 8 25666070 missense probably damaging 0.96
IGL03394:Nsd3 APN 8 25675749 splice site probably benign
Pine UTSW 8 25679936 missense possibly damaging 0.87
D3080:Nsd3 UTSW 8 25713545 missense possibly damaging 0.77
IGL02802:Nsd3 UTSW 8 25640906 missense probably damaging 1.00
R0136:Nsd3 UTSW 8 25659854 nonsense probably null
R0195:Nsd3 UTSW 8 25680693 missense probably damaging 1.00
R0207:Nsd3 UTSW 8 25683257 missense probably benign 0.02
R0471:Nsd3 UTSW 8 25648434 splice site probably benign
R0511:Nsd3 UTSW 8 25678716 missense possibly damaging 0.81
R0524:Nsd3 UTSW 8 25700577 missense possibly damaging 0.90
R0581:Nsd3 UTSW 8 25710691 missense probably damaging 1.00
R0589:Nsd3 UTSW 8 25641287 missense probably damaging 1.00
R0645:Nsd3 UTSW 8 25709069 missense probably benign 0.08
R0664:Nsd3 UTSW 8 25714240 missense probably damaging 0.97
R0738:Nsd3 UTSW 8 25678709 splice site probably null
R1148:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1148:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1265:Nsd3 UTSW 8 25682562 missense probably benign
R1298:Nsd3 UTSW 8 25679936 missense possibly damaging 0.87
R1424:Nsd3 UTSW 8 25700566 missense probably damaging 1.00
R1493:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1528:Nsd3 UTSW 8 25698767 missense probably damaging 1.00
R2051:Nsd3 UTSW 8 25691089 missense probably damaging 0.99
R2199:Nsd3 UTSW 8 25666057 missense probably damaging 0.99
R3414:Nsd3 UTSW 8 25700019 missense probably damaging 1.00
R3522:Nsd3 UTSW 8 25706614 missense probably benign
R3623:Nsd3 UTSW 8 25662819 missense probably damaging 0.98
R3624:Nsd3 UTSW 8 25662819 missense probably damaging 0.98
R3798:Nsd3 UTSW 8 25698845 missense probably damaging 1.00
R4345:Nsd3 UTSW 8 25641317 missense probably benign 0.04
R4370:Nsd3 UTSW 8 25648508 missense probably benign 0.13
R4421:Nsd3 UTSW 8 25641272 missense probably damaging 0.99
R4583:Nsd3 UTSW 8 25710676 missense probably benign 0.20
R4664:Nsd3 UTSW 8 25698866 missense probably damaging 1.00
R4741:Nsd3 UTSW 8 25673366 missense probably damaging 1.00
R4876:Nsd3 UTSW 8 25691134 missense possibly damaging 0.94
R4888:Nsd3 UTSW 8 25698911 missense probably damaging 1.00
R5000:Nsd3 UTSW 8 25682577 missense probably damaging 1.00
R5132:Nsd3 UTSW 8 25678839 missense possibly damaging 0.73
R5632:Nsd3 UTSW 8 25679969 missense probably benign 0.00
R5778:Nsd3 UTSW 8 25659818 missense probably damaging 1.00
R5779:Nsd3 UTSW 8 25682669 nonsense probably null
R5860:Nsd3 UTSW 8 25666091 missense probably damaging 0.98
R5911:Nsd3 UTSW 8 25666076 missense probably damaging 1.00
R6168:Nsd3 UTSW 8 25691161 missense probably null 1.00
R6467:Nsd3 UTSW 8 25640630 missense probably damaging 1.00
R6490:Nsd3 UTSW 8 25714185 missense probably damaging 1.00
R6519:Nsd3 UTSW 8 25662939 missense probably damaging 1.00
R6554:Nsd3 UTSW 8 25662875 missense probably damaging 0.99
R7038:Nsd3 UTSW 8 25641263 missense probably damaging 1.00
R7088:Nsd3 UTSW 8 25666034 missense probably benign 0.40
R7244:Nsd3 UTSW 8 25666039 missense probably damaging 0.96
R7308:Nsd3 UTSW 8 25640724 missense probably damaging 1.00
X0026:Nsd3 UTSW 8 25700593 missense probably damaging 1.00
Z1088:Nsd3 UTSW 8 25641002 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ATCACTGTAGGGGTCACAGG -3'
(R):5'- CAAACCATGAGGATTAGCAGGC -3'

Sequencing Primer
(F):5'- GGACCCCTAGAACAGTCTCATGTG -3'
(R):5'- GCAGGCTGCAGTACCTTTTGC -3'
Posted On2016-11-21