Incidental Mutation 'R0027:Cdkl3'
ID44525
Institutional Source Beutler Lab
Gene Symbol Cdkl3
Ensembl Gene ENSMUSG00000020389
Gene Namecyclin-dependent kinase-like 3
SynonymsB230379H01Rik
MMRRC Submission 038322-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.844) question?
Stock #R0027 (G1) of strain 730
Quality Score195
Status Validated (trace)
Chromosome11
Chromosomal Location52004221-52089784 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 52032349 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000063303] [ENSMUST00000063321] [ENSMUST00000109076] [ENSMUST00000109077] [ENSMUST00000109078] [ENSMUST00000109079] [ENSMUST00000109080] [ENSMUST00000109081] [ENSMUST00000120374] [ENSMUST00000121591] [ENSMUST00000128853] [ENSMUST00000143228] [ENSMUST00000150736]
Predicted Effect probably benign
Transcript: ENSMUST00000063303
SMART Domains Protein: ENSMUSP00000064315
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000063321
SMART Domains Protein: ENSMUSP00000065128
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 9e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109076
SMART Domains Protein: ENSMUSP00000104704
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109077
SMART Domains Protein: ENSMUSP00000104705
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109078
SMART Domains Protein: ENSMUSP00000104706
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 457 8e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109079
SMART Domains Protein: ENSMUSP00000104707
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 9e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109080
SMART Domains Protein: ENSMUSP00000104708
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109081
SMART Domains Protein: ENSMUSP00000104709
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000120374
SMART Domains Protein: ENSMUSP00000113303
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000121591
SMART Domains Protein: ENSMUSP00000112477
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000128853
SMART Domains Protein: ENSMUSP00000121945
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
Blast:S_TKc 1 110 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000136021
Predicted Effect probably benign
Transcript: ENSMUST00000143228
SMART Domains Protein: ENSMUSP00000123279
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000147874
SMART Domains Protein: ENSMUSP00000119505
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
Blast:S_TKc 2 36 5e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150736
Predicted Effect probably benign
Transcript: ENSMUST00000154701
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181262
Predicted Effect probably benign
Transcript: ENSMUST00000207272
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of Saccharomyces cerevisiae cdc28, and Schizosaccharomyces pombe cdc2, and are known to be important regulators of cell cycle progression. This gene was identified as a gene absent in leukemic patients with chromosome 5q deletion. This loss may be an important determinant of dysmyelopoiesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A T 15: 11,285,873 I723F probably damaging Het
Anapc1 G T 2: 128,641,511 D1221E possibly damaging Het
Arhgef28 T A 13: 97,945,696 E1201V possibly damaging Het
Capn12 T A 7: 28,881,960 H79Q probably benign Het
Caprin1 A T 2: 103,775,580 probably benign Het
Carmil3 T A 14: 55,494,403 F196Y probably damaging Het
Casp8ap2 A G 4: 32,643,810 H961R probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Col13a1 A G 10: 61,850,161 L684P unknown Het
D10Wsu102e G A 10: 83,364,529 probably benign Het
D430041D05Rik A T 2: 104,255,044 F1053L probably benign Het
Dab1 T C 4: 104,704,199 probably benign Het
Dmxl1 A T 18: 49,957,295 probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
E130309D02Rik G A 5: 143,308,062 T220I probably damaging Het
Eml1 T C 12: 108,536,298 C708R possibly damaging Het
Fam131b T A 6: 42,318,248 M304L probably benign Het
Foxk1 A T 5: 142,450,340 I321F probably damaging Het
Gm10306 C T 4: 94,556,790 probably benign Het
Gm10985 TA TANA 3: 53,845,256 probably null Het
Gse1 T C 8: 120,566,546 probably benign Het
Hcn3 A G 3: 89,159,825 S79P probably damaging Het
Hspa4 T A 11: 53,283,585 M203L probably benign Het
Kctd7 G A 5: 130,152,573 R279H probably damaging Het
Kif11 C T 19: 37,406,983 probably benign Het
Klf13 T C 7: 63,891,761 N206S probably benign Het
Kpna7 A T 5: 144,989,697 Y482N probably damaging Het
Lamc1 T C 1: 153,262,583 Y175C probably damaging Het
Lrpprc G A 17: 84,767,007 R491* probably null Het
Madd T A 2: 91,152,549 I1350F probably damaging Het
Mbtd1 T C 11: 93,924,549 V321A possibly damaging Het
Mon2 G A 10: 123,036,048 S357L possibly damaging Het
Ndst3 A G 3: 123,671,513 V270A probably damaging Het
Nlrp2 T C 7: 5,322,448 T742A probably damaging Het
Olfr214 T C 6: 116,556,949 S175P probably damaging Het
Papola A C 12: 105,833,136 S675R probably benign Het
Pcdh9 T A 14: 93,888,645 I30F probably null Het
Prl6a1 T A 13: 27,318,028 L126Q probably damaging Het
Prr29 A G 11: 106,376,276 E89G possibly damaging Het
Psmd1 T C 1: 86,094,265 probably benign Het
Rad9b A G 5: 122,351,723 probably benign Het
Rest T C 5: 77,282,551 V939A probably benign Het
Rnf135 T A 11: 80,193,942 S180R probably benign Het
Sarm1 C A 11: 78,488,091 R376L probably damaging Het
Scap C A 9: 110,379,730 P613Q probably benign Het
Scube3 C T 17: 28,164,357 R374* probably null Het
Setx T G 2: 29,139,221 V167G probably damaging Het
Snrnp40 T A 4: 130,368,273 H151Q probably damaging Het
Sox21 G T 14: 118,235,617 H7N probably benign Het
Stard9 A T 2: 120,703,501 Q3413L probably benign Het
Sycp1 A G 3: 102,895,910 V528A probably benign Het
Tcl1b3 A T 12: 105,191,239 S47C probably damaging Het
Treml4 T C 17: 48,264,934 S122P possibly damaging Het
Trip11 C T 12: 101,885,169 A879T probably benign Het
Ubr4 C A 4: 139,400,393 N567K probably damaging Het
Zan T C 5: 137,406,519 probably benign Het
Zfp804a G A 2: 82,257,200 D458N probably damaging Het
Zic2 T C 14: 122,476,343 M223T possibly damaging Het
Other mutations in Cdkl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdkl3 APN 11 52029856 missense probably benign 0.28
IGL01632:Cdkl3 APN 11 52005072 missense probably damaging 1.00
IGL01768:Cdkl3 APN 11 52025917 missense probably damaging 1.00
IGL01974:Cdkl3 APN 11 52011237 missense probably damaging 1.00
IGL01981:Cdkl3 APN 11 52005069 missense probably benign 0.43
IGL02510:Cdkl3 APN 11 52011270 missense probably damaging 1.00
R0027:Cdkl3 UTSW 11 52032349 unclassified probably benign
R0480:Cdkl3 UTSW 11 52005055 missense probably damaging 1.00
R0499:Cdkl3 UTSW 11 52032416 missense possibly damaging 0.52
R0627:Cdkl3 UTSW 11 52011308 missense probably damaging 1.00
R0848:Cdkl3 UTSW 11 52011267 missense probably damaging 1.00
R1510:Cdkl3 UTSW 11 52033514 missense possibly damaging 0.90
R1558:Cdkl3 UTSW 11 52032510 missense possibly damaging 0.62
R2046:Cdkl3 UTSW 11 52026850 missense probably benign
R2077:Cdkl3 UTSW 11 52026839 missense probably damaging 0.98
R2207:Cdkl3 UTSW 11 52027193 makesense probably null
R2271:Cdkl3 UTSW 11 52032495 missense probably benign 0.07
R2272:Cdkl3 UTSW 11 52032495 missense probably benign 0.07
R4032:Cdkl3 UTSW 11 52011291 missense probably damaging 1.00
R4839:Cdkl3 UTSW 11 52005034 missense probably damaging 1.00
R4971:Cdkl3 UTSW 11 52011168 missense possibly damaging 0.48
R6541:Cdkl3 UTSW 11 52022744 missense probably damaging 1.00
R6559:Cdkl3 UTSW 11 52025869 missense probably benign 0.04
R7034:Cdkl3 UTSW 11 52027215 missense probably benign 0.00
R7068:Cdkl3 UTSW 11 52011327 critical splice donor site probably null
R7406:Cdkl3 UTSW 11 52033542 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GGCTTCCATCTTTACAAATCACAAGACG -3'
(R):5'- TGCACTGTGAATGGCAGTTCAGG -3'

Sequencing Primer
(F):5'- gcaggaggcagaggcag -3'
(R):5'- TGAATGGCAGTTCAGGGAAATG -3'
Posted On2013-06-11