Incidental Mutation 'R5761:Cntnap5b'
ID445273
Institutional Source Beutler Lab
Gene Symbol Cntnap5b
Ensembl Gene ENSMUSG00000067028
Gene Namecontactin associated protein-like 5B
SynonymsCaspr5-2, C230078M14Rik
MMRRC Submission 043363-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5761 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location99772765-100485942 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100446894 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1123 (S1123P)
Ref Sequence ENSEMBL: ENSMUSP00000083944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086738] [ENSMUST00000188735]
Predicted Effect probably damaging
Transcript: ENSMUST00000086738
AA Change: S1123P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083944
Gene: ENSMUSG00000067028
AA Change: S1123P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FA58C 39 174 2.76e-16 SMART
LamG 201 338 2.84e-27 SMART
LamG 387 521 9.22e-27 SMART
EGF 549 583 1.14e0 SMART
Blast:FBG 586 758 3e-66 BLAST
LamG 798 925 2.12e-26 SMART
EGF 946 982 1.51e0 SMART
LamG 1023 1159 2.14e-13 SMART
transmembrane domain 1227 1249 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188735
AA Change: S752P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139877
Gene: ENSMUSG00000067028
AA Change: S752P

DomainStartEndE-ValueType
LamG 73 207 5.9e-29 SMART
EGF 235 269 5.6e-3 SMART
Blast:FBG 272 402 2e-42 BLAST
LamG 415 554 2.5e-11 SMART
EGF 575 611 7.1e-3 SMART
LamG 652 788 1.4e-15 SMART
transmembrane domain 856 878 N/A INTRINSIC
Meta Mutation Damage Score 0.22 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,210,101 V953D probably damaging Het
Abcb8 T C 5: 24,405,881 probably benign Het
Acad12 A T 5: 121,604,180 probably benign Het
Adam2 A T 14: 66,046,146 C436S probably damaging Het
Aebp2 T C 6: 140,624,217 probably benign Het
AI314180 T C 4: 58,853,131 I401M probably damaging Het
Akap8 A T 17: 32,317,185 C85S possibly damaging Het
Aldh1a3 C A 7: 66,419,179 R19L probably damaging Het
Baz2a A G 10: 128,119,690 T848A possibly damaging Het
Bud13 C T 9: 46,288,052 A237V probably benign Het
Cbarp CGCCTCTGCTGCCTCT CGCCTCT 10: 80,132,233 probably benign Het
Ccdc187 G A 2: 26,276,092 P775L possibly damaging Het
Ccz1 C T 5: 143,992,510 G367R probably damaging Het
Cep104 T C 4: 153,981,224 V56A possibly damaging Het
Chd6 C A 2: 160,957,078 R2362S probably damaging Het
Chd6 C T 2: 160,957,079 R2362K probably damaging Het
Cmc1 T C 9: 118,115,375 E25G probably benign Het
Col4a3 T A 1: 82,716,057 L66* probably null Het
Crmp1 A G 5: 37,282,868 T329A probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp3a16 A G 5: 145,442,033 S393P possibly damaging Het
Cyp4f18 T A 8: 71,996,131 I225F probably damaging Het
Ddhd2 A G 8: 25,741,699 V432A probably benign Het
Foxq1 G A 13: 31,559,331 A139T probably damaging Het
Gm10428 G T 11: 62,753,343 probably benign Het
Gpr89 A G 3: 96,892,880 L134P probably damaging Het
Hfe2 T C 3: 96,528,622 S399P probably benign Het
Hrc A T 7: 45,336,601 probably null Het
Igf1r T A 7: 68,207,253 Y988N probably damaging Het
Igf2r A C 17: 12,698,352 probably null Het
Itga2b A G 11: 102,466,274 F260S probably benign Het
Kif2a T A 13: 106,962,164 N698I probably benign Het
Lap3 A C 5: 45,504,805 I316L probably benign Het
Map2k6 T G 11: 110,399,371 probably benign Het
Myh1 A G 11: 67,219,252 E1422G probably damaging Het
Ncoa6 A G 2: 155,408,141 V1081A probably benign Het
Nom1 A G 5: 29,437,641 E380G probably damaging Het
Nwd2 A T 5: 63,725,230 Y75F probably damaging Het
Olfr401 T A 11: 74,121,509 D73E probably damaging Het
Olfr645 G A 7: 104,084,169 R304W probably benign Het
Pkd1l1 A G 11: 8,916,301 V518A probably damaging Het
Ptgs2 A G 1: 150,105,528 M521V probably benign Het
Qsox1 T A 1: 155,779,528 M630L probably benign Het
Skiv2l2 T A 13: 112,917,662 I146F probably damaging Het
Spty2d1 A G 7: 46,998,284 L299P probably damaging Het
St6gal1 T G 16: 23,321,055 probably benign Het
Sult2a6 T C 7: 14,250,358 Y149C probably damaging Het
Tlr3 G A 8: 45,402,771 T124M probably benign Het
Tmem171 A G 13: 98,692,511 Y44H probably damaging Het
Usp35 C T 7: 97,312,351 V623I probably benign Het
Vangl2 T A 1: 172,006,127 H463L probably damaging Het
Vmn1r175 A C 7: 23,808,480 L241V probably benign Het
Vmn1r19 A T 6: 57,405,353 K297I unknown Het
Vmn2r23 C A 6: 123,712,759 T198K probably benign Het
Vmn2r-ps69 T A 7: 85,304,015 noncoding transcript Het
Xirp2 A G 2: 67,510,967 Y1184C probably benign Het
Ythdc1 A G 5: 86,835,951 probably benign Het
Zbtb39 C T 10: 127,742,646 A363V probably damaging Het
Zmiz1 C A 14: 25,651,306 P534T probably damaging Het
Zmiz1 T A 14: 25,651,304 I527K possibly damaging Het
Other mutations in Cntnap5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Cntnap5b APN 1 100050754 missense probably damaging 1.00
IGL00477:Cntnap5b APN 1 100213743 missense probably damaging 0.97
IGL00505:Cntnap5b APN 1 100379161 missense possibly damaging 0.81
IGL00596:Cntnap5b APN 1 100379161 missense possibly damaging 0.81
IGL00846:Cntnap5b APN 1 100164223 missense probably damaging 1.00
IGL00895:Cntnap5b APN 1 100383585 missense probably damaging 0.98
IGL00948:Cntnap5b APN 1 100141357 missense probably benign 0.00
IGL01073:Cntnap5b APN 1 100076030 missense probably benign 0.08
IGL01523:Cntnap5b APN 1 100431779 missense probably benign 0.02
IGL01779:Cntnap5b APN 1 99967339 missense probably damaging 1.00
IGL02253:Cntnap5b APN 1 100164211 missense possibly damaging 0.75
IGL02628:Cntnap5b APN 1 100072069 missense probably damaging 0.97
R0166:Cntnap5b UTSW 1 100274361 missense probably benign 0.41
R0211:Cntnap5b UTSW 1 100478374 missense possibly damaging 0.82
R0281:Cntnap5b UTSW 1 100072153 missense probably benign 0.22
R0363:Cntnap5b UTSW 1 100274468 missense probably benign 0.01
R0514:Cntnap5b UTSW 1 99772786 missense probably benign
R0645:Cntnap5b UTSW 1 100072042 splice site probably benign
R0848:Cntnap5b UTSW 1 100255163 missense probably benign 0.22
R1006:Cntnap5b UTSW 1 100383617 missense probably benign 0.00
R1349:Cntnap5b UTSW 1 100164088 missense probably benign 0.09
R1372:Cntnap5b UTSW 1 100164088 missense probably benign 0.09
R1474:Cntnap5b UTSW 1 100072089 missense probably benign 0.25
R1681:Cntnap5b UTSW 1 100076107 missense probably damaging 0.98
R1727:Cntnap5b UTSW 1 100213744 missense possibly damaging 0.91
R1760:Cntnap5b UTSW 1 99772810 missense probably benign 0.05
R1777:Cntnap5b UTSW 1 100370078 missense probably benign 0.10
R1939:Cntnap5b UTSW 1 99967348 missense probably benign
R1988:Cntnap5b UTSW 1 100072140 missense possibly damaging 0.92
R2069:Cntnap5b UTSW 1 100358725 missense probably benign 0.04
R2113:Cntnap5b UTSW 1 100274415 missense probably benign
R2148:Cntnap5b UTSW 1 100383474 missense probably benign 0.01
R2158:Cntnap5b UTSW 1 100390572 missense probably damaging 1.00
R2223:Cntnap5b UTSW 1 100213687 missense probably damaging 1.00
R2350:Cntnap5b UTSW 1 100379126 missense probably damaging 1.00
R3840:Cntnap5b UTSW 1 100383477 missense possibly damaging 0.50
R4329:Cntnap5b UTSW 1 100072163 missense probably damaging 0.99
R4609:Cntnap5b UTSW 1 99772847 critical splice donor site probably null
R4799:Cntnap5b UTSW 1 100358725 missense probably benign 0.04
R5129:Cntnap5b UTSW 1 100379090 missense probably damaging 1.00
R5323:Cntnap5b UTSW 1 100383550 nonsense probably null
R5434:Cntnap5b UTSW 1 100072201 missense probably benign 0.02
R5579:Cntnap5b UTSW 1 100383395 nonsense probably null
R5579:Cntnap5b UTSW 1 100383399 missense probably benign 0.27
R5630:Cntnap5b UTSW 1 100072069 missense probably damaging 0.99
R5644:Cntnap5b UTSW 1 100383601 missense probably benign 0.00
R6042:Cntnap5b UTSW 1 100390592 missense probably benign
R6147:Cntnap5b UTSW 1 100050781 missense probably damaging 1.00
R6190:Cntnap5b UTSW 1 100379075 missense possibly damaging 0.80
R6248:Cntnap5b UTSW 1 100072102 missense probably benign 0.30
R6286:Cntnap5b UTSW 1 100255073 missense possibly damaging 0.82
R6306:Cntnap5b UTSW 1 100164146 missense probably damaging 1.00
R6336:Cntnap5b UTSW 1 100358669 missense probably benign 0.00
R6360:Cntnap5b UTSW 1 100431736 nonsense probably null
R6722:Cntnap5b UTSW 1 100478486 missense probably damaging 0.98
R6750:Cntnap5b UTSW 1 100274499 missense probably damaging 1.00
R6806:Cntnap5b UTSW 1 99940649 missense probably damaging 1.00
R6933:Cntnap5b UTSW 1 100383450 missense probably benign 0.01
R6957:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6958:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6959:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6961:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6962:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R7088:Cntnap5b UTSW 1 100160077 missense probably damaging 0.99
R7146:Cntnap5b UTSW 1 100050794 splice site probably null
R7165:Cntnap5b UTSW 1 100076162 missense possibly damaging 0.94
R7190:Cntnap5b UTSW 1 100431849 splice site probably null
R7376:Cntnap5b UTSW 1 99967269 missense possibly damaging 0.92
R7385:Cntnap5b UTSW 1 100379090 missense probably damaging 1.00
X0020:Cntnap5b UTSW 1 100431848 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGATACTAAAGCACACAGGATTG -3'
(R):5'- TCTGCTTCATTGGCACATGTG -3'

Sequencing Primer
(F):5'- TACTAAAGCACACAGGATTGAAAAC -3'
(R):5'- CAGAGGTGACAAATTCCTC -3'
Posted On2016-11-21