Incidental Mutation 'R5771:Stard13'
ID445353
Institutional Source Beutler Lab
Gene Symbol Stard13
Ensembl Gene ENSMUSG00000016128
Gene NameStAR-related lipid transfer (START) domain containing 13
SynonymsGT650, DLC2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5771 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location151037510-151233836 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 151190011 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 28 (L28F)
Ref Sequence ENSEMBL: ENSMUSP00000106109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062015] [ENSMUST00000110483] [ENSMUST00000126770] [ENSMUST00000129088] [ENSMUST00000202365]
Predicted Effect probably damaging
Transcript: ENSMUST00000062015
AA Change: L28F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053232
Gene: ENSMUSG00000016128
AA Change: L28F

DomainStartEndE-ValueType
Pfam:SAM_2 59 120 2.6e-6 PFAM
low complexity region 197 216 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 612 624 N/A INTRINSIC
RhoGAP 693 884 2.37e-50 SMART
START 927 1129 2.08e-40 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110483
AA Change: L28F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106109
Gene: ENSMUSG00000016128
AA Change: L28F

DomainStartEndE-ValueType
PDB:2JW2|A 50 120 1e-37 PDB
low complexity region 197 216 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 612 624 N/A INTRINSIC
RhoGAP 674 865 2.37e-50 SMART
START 908 1110 2.08e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126770
SMART Domains Protein: ENSMUSP00000122468
Gene: ENSMUSG00000016128

DomainStartEndE-ValueType
Pfam:SAM_2 44 105 7.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129088
SMART Domains Protein: ENSMUSP00000116705
Gene: ENSMUSG00000016128

DomainStartEndE-ValueType
Blast:SAM 40 104 6e-32 BLAST
PDB:2JW2|A 42 104 8e-33 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201680
Predicted Effect probably benign
Transcript: ENSMUST00000202365
Meta Mutation Damage Score 0.262 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 95% (87/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains an N-terminal sterile alpha motif (SAM) for protein-protein interactions, followed by an ATP/GTP-binding motif, a GTPase-activating protein (GAP) domain, and a C-terminal STAR-related lipid transfer (START) domain. It may be involved in regulation of cytoskeletal reorganization, cell proliferation, and cell motility, and acts as a tumor suppressor in hepatoma cells. The gene is located in a region of chromosome 13 that is associated with loss of heterozygosity in hepatocellular carcinomas. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small body size, decreased weight, and reduced adipose tissue. Mice homozygous for another knock-out allele exhibit increased angiogenesis in matrigel plugs and implanted tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,291,411 N1091K probably damaging Het
Adam3 C T 8: 24,707,411 V335I probably benign Het
AI504432 G A 3: 107,048,983 noncoding transcript Het
Apcdd1 A G 18: 62,936,956 Y98C probably damaging Het
Aqp9 C T 9: 71,122,864 A214T probably damaging Het
Atp8b4 T C 2: 126,378,744 D578G probably benign Het
Bcdin3d T C 15: 99,470,836 M161V probably benign Het
Bicral C T 17: 46,825,358 V309I possibly damaging Het
Ccdc88b C T 19: 6,853,835 A580T probably benign Het
Cdhr2 T A 13: 54,726,695 V860E probably damaging Het
Clhc1 A T 11: 29,563,854 N302Y possibly damaging Het
Cnnm2 T A 19: 46,856,995 probably null Het
Crebbp T C 16: 4,119,772 N709S probably benign Het
Ctnnal1 T C 4: 56,826,328 S512G probably benign Het
Dgcr8 C T 16: 18,272,768 V581I probably benign Het
Dnah7c G A 1: 46,639,665 V1790I probably benign Het
Efl1 A G 7: 82,692,524 K452E probably benign Het
Epb42 A C 2: 121,021,820 V564G probably damaging Het
Etv4 G A 11: 101,771,456 P335S probably damaging Het
Fbxw9 T A 8: 85,064,572 probably null Het
Fcrls A T 3: 87,263,468 L3Q probably damaging Het
Frmd8 C A 19: 5,869,450 A190S probably benign Het
Gcm2 C T 13: 41,103,515 D253N probably benign Het
Gfm1 T C 3: 67,435,562 V143A probably benign Het
Gigyf2 T C 1: 87,446,328 M1226T possibly damaging Het
Gm10110 C T 14: 89,897,239 noncoding transcript Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm13757 A T 2: 88,446,308 V210D possibly damaging Het
Gm20939 T G 17: 94,874,339 C55W possibly damaging Het
Gm5407 T A 16: 49,296,866 noncoding transcript Het
Golga4 A G 9: 118,558,283 E1491G probably damaging Het
Hdac11 T A 6: 91,169,382 probably null Het
Hs3st3b1 C T 11: 63,889,272 S343N probably benign Het
Igkv12-44 G A 6: 69,815,091 P4S probably benign Het
Igkv1-35 C T 6: 70,011,247 V22I probably benign Het
Kcns2 A T 15: 34,838,922 T144S probably benign Het
Khdc1c T C 1: 21,369,042 V84A possibly damaging Het
Kif4-ps T A 12: 101,149,285 noncoding transcript Het
Lamc2 T G 1: 153,141,594 Y549S probably benign Het
Lect2 T A 13: 56,548,341 I8F probably benign Het
Loxl3 T A 6: 83,035,799 probably null Het
Lrwd1 A T 5: 136,123,662 I545N possibly damaging Het
Ltbp3 T C 19: 5,747,544 C437R probably damaging Het
Lypd3 T C 7: 24,640,362 S285P probably benign Het
Mast2 T A 4: 116,333,425 H83L possibly damaging Het
Mfsd4b4 A G 10: 39,892,639 F153L probably benign Het
Ms4a4b T A 19: 11,461,242 probably null Het
Nbr1 T A 11: 101,559,538 L41Q probably damaging Het
Nlrp4a G A 7: 26,453,389 C628Y probably damaging Het
Nup160 C T 2: 90,723,396 R1157C probably damaging Het
Obscn T A 11: 59,000,707 I7000F unknown Het
Olfr1287 T A 2: 111,450,061 probably null Het
Olfr1484 T G 19: 13,585,508 V25G probably damaging Het
Olfr194 TGAAGAAGAA TGAAGAA 16: 59,119,972 probably benign Het
Olfr229 A T 9: 39,910,250 Y149F probably damaging Het
Pdilt T C 7: 119,494,994 K345E probably damaging Het
Ppp1r12b A T 1: 134,773,424 probably null Het
Ppp2r1b A T 9: 50,866,832 Q219L probably damaging Het
Prim2 A G 1: 33,454,151 S485P unknown Het
Prkdc A G 16: 15,664,233 D380G probably damaging Het
Psmg1 A G 16: 95,982,169 L243S probably damaging Het
Rapgef5 T A 12: 117,721,326 V270D probably benign Het
Rnft1 C T 11: 86,493,206 R311* probably null Het
Scaper T A 9: 55,816,791 I628L probably damaging Het
Serpina3j C A 12: 104,314,926 H119Q possibly damaging Het
Slamf6 G A 1: 171,917,774 V23I probably damaging Het
Slc12a5 T A 2: 164,973,768 M45K possibly damaging Het
Slc25a11 A C 11: 70,646,190 V13G probably damaging Het
Slc7a14 T A 3: 31,238,707 Y143F probably damaging Het
Spryd3 A G 15: 102,116,907 probably benign Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Taf2 A G 15: 55,059,939 V314A probably benign Het
Tas2r106 T C 6: 131,678,123 N255S possibly damaging Het
Tbxa2r T A 10: 81,332,941 W155R probably damaging Het
Tcf3 A G 10: 80,421,616 probably benign Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Vmn2r55 T C 7: 12,671,032 D148G probably damaging Het
Vmn2r77 A G 7: 86,812,027 N854D probably benign Het
Vstm4 A T 14: 32,904,569 H64L probably benign Het
Wdr92 A G 11: 17,224,638 T169A probably benign Het
Wnk2 T C 13: 49,102,800 T282A probably damaging Het
Zscan4c A T 7: 11,009,647 D391V probably benign Het
Other mutations in Stard13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Stard13 APN 5 151042239 missense probably damaging 1.00
IGL01362:Stard13 APN 5 151189952 missense probably benign 0.05
IGL01588:Stard13 APN 5 151045237 missense probably damaging 1.00
IGL01947:Stard13 APN 5 151062844 missense probably damaging 1.00
IGL02294:Stard13 APN 5 151063115 missense probably benign 0.19
IGL02713:Stard13 APN 5 151042186 nonsense probably null
IGL02746:Stard13 APN 5 151046857 splice site probably benign
IGL02827:Stard13 APN 5 151063126 missense probably benign 0.07
R0498:Stard13 UTSW 5 151052477 missense probably damaging 1.00
R1427:Stard13 UTSW 5 151045991 missense probably damaging 0.99
R1785:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R1857:Stard13 UTSW 5 151095438 missense probably damaging 1.00
R1858:Stard13 UTSW 5 151095438 missense probably damaging 1.00
R2130:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2131:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2132:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2133:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2258:Stard13 UTSW 5 151039731 missense probably damaging 1.00
R3435:Stard13 UTSW 5 151042179 missense probably damaging 1.00
R4080:Stard13 UTSW 5 151092829 critical splice acceptor site probably null
R4081:Stard13 UTSW 5 151092829 critical splice acceptor site probably null
R4082:Stard13 UTSW 5 151092829 critical splice acceptor site probably null
R4233:Stard13 UTSW 5 151062699 missense probably benign 0.00
R4288:Stard13 UTSW 5 151045177 missense probably damaging 1.00
R4303:Stard13 UTSW 5 151062869 missense possibly damaging 0.82
R4659:Stard13 UTSW 5 151062788 missense probably benign 0.01
R4695:Stard13 UTSW 5 151060815 missense probably benign 0.08
R4910:Stard13 UTSW 5 151062527 missense probably benign
R5135:Stard13 UTSW 5 151062767 nonsense probably null
R5338:Stard13 UTSW 5 151059598 missense probably damaging 1.00
R5399:Stard13 UTSW 5 151047801 nonsense probably null
R5546:Stard13 UTSW 5 151045901 missense probably benign 0.03
R5685:Stard13 UTSW 5 151063127 missense possibly damaging 0.78
R6034:Stard13 UTSW 5 151095500 splice site probably null
R6034:Stard13 UTSW 5 151095500 splice site probably null
R6141:Stard13 UTSW 5 151042242 missense probably damaging 1.00
R6171:Stard13 UTSW 5 151092762 missense probably damaging 1.00
R6296:Stard13 UTSW 5 151062673 missense probably damaging 1.00
R6326:Stard13 UTSW 5 151046919 missense possibly damaging 0.95
R6508:Stard13 UTSW 5 151063289 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACAGACTGCTTAGAACCGAAGTC -3'
(R):5'- AAAATCGCTGGGTCTGTGGC -3'

Sequencing Primer
(F):5'- GTTATCTGAAAGAGTTCCACGCAGC -3'
(R):5'- GGGTCTGTGGCTCTCTCC -3'
Posted On2016-11-21