Incidental Mutation 'R0027:Zic2'
ID44540
Institutional Source Beutler Lab
Gene Symbol Zic2
Ensembl Gene ENSMUSG00000061524
Gene Namezinc finger protein of the cerebellum 2
Synonymsodd-paired homolog, GENA 29, Ku
MMRRC Submission 038322-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.924) question?
Stock #R0027 (G1) of strain 730
Quality Score163
Status Validated
Chromosome14
Chromosomal Location122475435-122479852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122476343 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 223 (M223T)
Ref Sequence ENSEMBL: ENSMUSP00000075283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075888]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075888
AA Change: M223T

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000075283
Gene: ENSMUSG00000061524
AA Change: M223T

DomainStartEndE-ValueType
low complexity region 18 33 N/A INTRINSIC
low complexity region 81 103 N/A INTRINSIC
low complexity region 131 150 N/A INTRINSIC
low complexity region 215 241 N/A INTRINSIC
ZnF_C2H2 265 290 5.68e1 SMART
ZnF_C2H2 299 326 6.92e0 SMART
ZnF_C2H2 332 356 8.02e-5 SMART
ZnF_C2H2 362 386 1.69e-3 SMART
ZnF_C2H2 392 414 4.54e-4 SMART
low complexity region 416 434 N/A INTRINSIC
low complexity region 455 519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177306
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. This protein functions as a transcriptional repressor and may regulate tissue specific expression of dopamine receptor D1. Expansion of an alanine repeat in the C-terminus of the encoded protein and other mutations in this gene cause holoprosencephaly type 5. Holoprosencephaly is the most common structural anomaly of the human brain. A polyhistidine tract polymorphism in this gene may be associated with increased risk of neural tube defects. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 5, a related family member on chromosome 13. [provided by RefSeq, Jul 2016]
PHENOTYPE: Defects in neurulation and forebrain development have been identified in both targeted and ENU induced homozygous mutants. Death occurs perinatally in the targeted mouse and during midgestation in the ENU mouse. Mice homozygous for a knock-down allele exhibit cognitive and social behavior defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A T 15: 11,285,873 I723F probably damaging Het
Anapc1 G T 2: 128,641,511 D1221E possibly damaging Het
Arhgef28 T A 13: 97,945,696 E1201V possibly damaging Het
Capn12 T A 7: 28,881,960 H79Q probably benign Het
Caprin1 A T 2: 103,775,580 probably benign Het
Carmil3 T A 14: 55,494,403 F196Y probably damaging Het
Casp8ap2 A G 4: 32,643,810 H961R probably benign Het
Cdkl3 C T 11: 52,032,349 probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Col13a1 A G 10: 61,850,161 L684P unknown Het
D10Wsu102e G A 10: 83,364,529 probably benign Het
D430041D05Rik A T 2: 104,255,044 F1053L probably benign Het
Dab1 T C 4: 104,704,199 probably benign Het
Dmxl1 A T 18: 49,957,295 probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
E130309D02Rik G A 5: 143,308,062 T220I probably damaging Het
Eml1 T C 12: 108,536,298 C708R possibly damaging Het
Fam131b T A 6: 42,318,248 M304L probably benign Het
Foxk1 A T 5: 142,450,340 I321F probably damaging Het
Gm10306 C T 4: 94,556,790 probably benign Het
Gm10985 TA TANA 3: 53,845,256 probably null Het
Gse1 T C 8: 120,566,546 probably benign Het
Hcn3 A G 3: 89,159,825 S79P probably damaging Het
Hspa4 T A 11: 53,283,585 M203L probably benign Het
Kctd7 G A 5: 130,152,573 R279H probably damaging Het
Kif11 C T 19: 37,406,983 probably benign Het
Klf13 T C 7: 63,891,761 N206S probably benign Het
Kpna7 A T 5: 144,989,697 Y482N probably damaging Het
Lamc1 T C 1: 153,262,583 Y175C probably damaging Het
Lrpprc G A 17: 84,767,007 R491* probably null Het
Madd T A 2: 91,152,549 I1350F probably damaging Het
Mbtd1 T C 11: 93,924,549 V321A possibly damaging Het
Mon2 G A 10: 123,036,048 S357L possibly damaging Het
Ndst3 A G 3: 123,671,513 V270A probably damaging Het
Nlrp2 T C 7: 5,322,448 T742A probably damaging Het
Olfr214 T C 6: 116,556,949 S175P probably damaging Het
Papola A C 12: 105,833,136 S675R probably benign Het
Pcdh9 T A 14: 93,888,645 I30F probably null Het
Prl6a1 T A 13: 27,318,028 L126Q probably damaging Het
Prr29 A G 11: 106,376,276 E89G possibly damaging Het
Psmd1 T C 1: 86,094,265 probably benign Het
Rad9b A G 5: 122,351,723 probably benign Het
Rest T C 5: 77,282,551 V939A probably benign Het
Rnf135 T A 11: 80,193,942 S180R probably benign Het
Sarm1 C A 11: 78,488,091 R376L probably damaging Het
Scap C A 9: 110,379,730 P613Q probably benign Het
Scube3 C T 17: 28,164,357 R374* probably null Het
Setx T G 2: 29,139,221 V167G probably damaging Het
Snrnp40 T A 4: 130,368,273 H151Q probably damaging Het
Sox21 G T 14: 118,235,617 H7N probably benign Het
Stard9 A T 2: 120,703,501 Q3413L probably benign Het
Sycp1 A G 3: 102,895,910 V528A probably benign Het
Tcl1b3 A T 12: 105,191,239 S47C probably damaging Het
Treml4 T C 17: 48,264,934 S122P possibly damaging Het
Trip11 C T 12: 101,885,169 A879T probably benign Het
Ubr4 C A 4: 139,400,393 N567K probably damaging Het
Zan T C 5: 137,406,519 probably benign Het
Zfp804a G A 2: 82,257,200 D458N probably damaging Het
Other mutations in Zic2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Zic2 APN 14 122478559 nonsense probably null
IGL01607:Zic2 APN 14 122478882 splice site probably benign
IGL02307:Zic2 APN 14 122476634 missense possibly damaging 0.76
IGL02311:Zic2 APN 14 122476194 missense probably damaging 0.99
IGL02561:Zic2 APN 14 122478545 nonsense probably null
IGL02982:Zic2 APN 14 122478567 missense probably damaging 0.98
R0001:Zic2 UTSW 14 122478957 missense probably damaging 0.99
R0136:Zic2 UTSW 14 122476541 missense probably damaging 0.96
R0310:Zic2 UTSW 14 122476364 small deletion probably benign
R0418:Zic2 UTSW 14 122476364 small deletion probably benign
R0420:Zic2 UTSW 14 122476364 small deletion probably benign
R0421:Zic2 UTSW 14 122476364 small deletion probably benign
R0518:Zic2 UTSW 14 122476364 small deletion probably benign
R0520:Zic2 UTSW 14 122476364 small deletion probably benign
R0521:Zic2 UTSW 14 122476364 small deletion probably benign
R0628:Zic2 UTSW 14 122476364 small deletion probably benign
R1733:Zic2 UTSW 14 122478947 missense probably damaging 0.97
R1757:Zic2 UTSW 14 122478619 missense possibly damaging 0.86
R2398:Zic2 UTSW 14 122478917 nonsense probably null
R5323:Zic2 UTSW 14 122476316 missense probably damaging 1.00
R5381:Zic2 UTSW 14 122475815 missense probably damaging 0.97
R6930:Zic2 UTSW 14 122476457 missense probably damaging 0.99
R7223:Zic2 UTSW 14 122476091 missense probably damaging 0.98
Z1088:Zic2 UTSW 14 122478675 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AACGTGCTCAATGGGCAAATGC -3'
(R):5'- AAAACAAGCCCTGGCTGTCCTG -3'

Sequencing Primer
(F):5'- AGCAATACCGCCAAGTGG -3'
(R):5'- cacacacacacacacacacG -3'
Posted On2013-06-11