Incidental Mutation 'R5771:Ticam1'
ID445410
Institutional Source Beutler Lab
Gene Symbol Ticam1
Ensembl Gene ENSMUSG00000047123
Gene Nametoll-like receptor adaptor molecule 1
SynonymsTICAM-1, Trif
MMRRC Submission 043371-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5771 (G1)
Quality Score217
Status Validated
Chromosome17
Chromosomal Location56269319-56276786 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TCACACA to TCACA at 56270629 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000055104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058136]
Predicted Effect probably null
Transcript: ENSMUST00000058136
SMART Domains Protein: ENSMUSP00000055104
Gene: ENSMUSG00000047123

DomainStartEndE-ValueType
PDB:4BSX|D 5 153 3e-52 PDB
low complexity region 345 384 N/A INTRINSIC
SCOP:d1fyva_ 386 491 8e-3 SMART
PDB:2M1X|A 391 547 1e-74 PDB
Pfam:RHIM 610 698 4.7e-13 PFAM
Meta Mutation Damage Score 0.5876 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 95% (87/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein containing a Toll/interleukin-1 receptor (TIR) homology domain, which is an intracellular signaling domain that mediates protein-protein interactions between the Toll-like receptors (TLRs) and signal-transduction components. This protein is involved in native immunity against invading pathogens. It specifically interacts with toll-like receptor 3, but not with other TLRs, and this association mediates dsRNA induction of interferon-beta through activation of nuclear factor kappa-B, during an antiviral immune response. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice are viable but exhibit abnormalities of the innate immune system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,291,411 N1091K probably damaging Het
Adam3 C T 8: 24,707,411 V335I probably benign Het
AI504432 G A 3: 107,048,983 noncoding transcript Het
Apcdd1 A G 18: 62,936,956 Y98C probably damaging Het
Aqp9 C T 9: 71,122,864 A214T probably damaging Het
Atp8b4 T C 2: 126,378,744 D578G probably benign Het
Bcdin3d T C 15: 99,470,836 M161V probably benign Het
Bicral C T 17: 46,825,358 V309I possibly damaging Het
Ccdc88b C T 19: 6,853,835 A580T probably benign Het
Cdhr2 T A 13: 54,726,695 V860E probably damaging Het
Clhc1 A T 11: 29,563,854 N302Y possibly damaging Het
Cnnm2 T A 19: 46,856,995 probably null Het
Crebbp T C 16: 4,119,772 N709S probably benign Het
Ctnnal1 T C 4: 56,826,328 S512G probably benign Het
Dgcr8 C T 16: 18,272,768 V581I probably benign Het
Dnah7c G A 1: 46,639,665 V1790I probably benign Het
Efl1 A G 7: 82,692,524 K452E probably benign Het
Epb42 A C 2: 121,021,820 V564G probably damaging Het
Etv4 G A 11: 101,771,456 P335S probably damaging Het
Fbxw9 T A 8: 85,064,572 probably null Het
Fcrls A T 3: 87,263,468 L3Q probably damaging Het
Frmd8 C A 19: 5,869,450 A190S probably benign Het
Gcm2 C T 13: 41,103,515 D253N probably benign Het
Gfm1 T C 3: 67,435,562 V143A probably benign Het
Gigyf2 T C 1: 87,446,328 M1226T possibly damaging Het
Gm10110 C T 14: 89,897,239 noncoding transcript Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm13757 A T 2: 88,446,308 V210D possibly damaging Het
Gm20939 T G 17: 94,874,339 C55W possibly damaging Het
Gm5407 T A 16: 49,296,866 noncoding transcript Het
Golga4 A G 9: 118,558,283 E1491G probably damaging Het
Hdac11 T A 6: 91,169,382 probably null Het
Hs3st3b1 C T 11: 63,889,272 S343N probably benign Het
Igkv12-44 G A 6: 69,815,091 P4S probably benign Het
Igkv1-35 C T 6: 70,011,247 V22I probably benign Het
Kcns2 A T 15: 34,838,922 T144S probably benign Het
Khdc1c T C 1: 21,369,042 V84A possibly damaging Het
Kif4-ps T A 12: 101,149,285 noncoding transcript Het
Lamc2 T G 1: 153,141,594 Y549S probably benign Het
Lect2 T A 13: 56,548,341 I8F probably benign Het
Loxl3 T A 6: 83,035,799 probably null Het
Lrwd1 A T 5: 136,123,662 I545N possibly damaging Het
Ltbp3 T C 19: 5,747,544 C437R probably damaging Het
Lypd3 T C 7: 24,640,362 S285P probably benign Het
Mast2 T A 4: 116,333,425 H83L possibly damaging Het
Mfsd4b4 A G 10: 39,892,639 F153L probably benign Het
Ms4a4b T A 19: 11,461,242 probably null Het
Nbr1 T A 11: 101,559,538 L41Q probably damaging Het
Nlrp4a G A 7: 26,453,389 C628Y probably damaging Het
Nup160 C T 2: 90,723,396 R1157C probably damaging Het
Obscn T A 11: 59,000,707 I7000F unknown Het
Olfr1287 T A 2: 111,450,061 probably null Het
Olfr1484 T G 19: 13,585,508 V25G probably damaging Het
Olfr194 TGAAGAAGAA TGAAGAA 16: 59,119,972 probably benign Het
Olfr229 A T 9: 39,910,250 Y149F probably damaging Het
Pdilt T C 7: 119,494,994 K345E probably damaging Het
Ppp1r12b A T 1: 134,773,424 probably null Het
Ppp2r1b A T 9: 50,866,832 Q219L probably damaging Het
Prim2 A G 1: 33,454,151 S485P unknown Het
Prkdc A G 16: 15,664,233 D380G probably damaging Het
Psmg1 A G 16: 95,982,169 L243S probably damaging Het
Rapgef5 T A 12: 117,721,326 V270D probably benign Het
Rnft1 C T 11: 86,493,206 R311* probably null Het
Scaper T A 9: 55,816,791 I628L probably damaging Het
Serpina3j C A 12: 104,314,926 H119Q possibly damaging Het
Slamf6 G A 1: 171,917,774 V23I probably damaging Het
Slc12a5 T A 2: 164,973,768 M45K possibly damaging Het
Slc25a11 A C 11: 70,646,190 V13G probably damaging Het
Slc7a14 T A 3: 31,238,707 Y143F probably damaging Het
Spryd3 A G 15: 102,116,907 probably benign Het
Stard13 C A 5: 151,190,011 L28F probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Taf2 A G 15: 55,059,939 V314A probably benign Het
Tas2r106 T C 6: 131,678,123 N255S possibly damaging Het
Tbxa2r T A 10: 81,332,941 W155R probably damaging Het
Tcf3 A G 10: 80,421,616 probably benign Het
Vmn2r55 T C 7: 12,671,032 D148G probably damaging Het
Vmn2r77 A G 7: 86,812,027 N854D probably benign Het
Vstm4 A T 14: 32,904,569 H64L probably benign Het
Wdr92 A G 11: 17,224,638 T169A probably benign Het
Wnk2 T C 13: 49,102,800 T282A probably damaging Het
Zscan4c A T 7: 11,009,647 D391V probably benign Het
Other mutations in Ticam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Ticam1 APN 17 56270560 missense possibly damaging 0.80
IGL02164:Ticam1 APN 17 56270019 missense unknown
Lps2 UTSW 17 56271576 small deletion
Pangu UTSW 17 56276693 critical splice donor site probably benign
Yue UTSW 17 56271339 missense probably benign 0.06
R0930:Ticam1 UTSW 17 56270226 missense unknown
R0930:Ticam1 UTSW 17 56271687 missense probably damaging 1.00
R1509:Ticam1 UTSW 17 56271113 missense probably benign 0.43
R1837:Ticam1 UTSW 17 56270799 missense possibly damaging 0.87
R1863:Ticam1 UTSW 17 56271436 missense probably damaging 1.00
R1867:Ticam1 UTSW 17 56271718 missense probably benign 0.01
R1872:Ticam1 UTSW 17 56271897 missense probably benign 0.00
R1893:Ticam1 UTSW 17 56271894 missense probably benign 0.36
R1980:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R1981:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R1982:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R2263:Ticam1 UTSW 17 56271888 missense possibly damaging 0.95
R2513:Ticam1 UTSW 17 56271612 missense possibly damaging 0.61
R4294:Ticam1 UTSW 17 56271339 missense probably benign 0.06
R4888:Ticam1 UTSW 17 56271642 missense probably damaging 0.98
R4982:Ticam1 UTSW 17 56272020 missense probably benign 0.10
R5396:Ticam1 UTSW 17 56271117 missense probably benign 0.02
R5604:Ticam1 UTSW 17 56271756 missense probably benign 0.13
R5641:Ticam1 UTSW 17 56270629 frame shift probably null
R5647:Ticam1 UTSW 17 56270629 frame shift probably null
R5648:Ticam1 UTSW 17 56270629 frame shift probably null
R5657:Ticam1 UTSW 17 56270629 frame shift probably null
R5770:Ticam1 UTSW 17 56270629 frame shift probably null
R5964:Ticam1 UTSW 17 56271703 missense probably damaging 0.99
R5974:Ticam1 UTSW 17 56271178 missense probably benign
R6217:Ticam1 UTSW 17 56270730 missense probably damaging 1.00
R6983:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6984:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6985:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6986:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6987:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6988:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6989:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R7029:Ticam1 UTSW 17 56271154 missense possibly damaging 0.51
V8831:Ticam1 UTSW 17 56269969 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TATGGCTGCCACGTTTTGC -3'
(R):5'- TGTGAGGAATTTCAGGTGCC -3'

Sequencing Primer
(F):5'- CTTGAGGGTTCTGGCCTCC -3'
(R):5'- AATTTCAGGTGCCCGGGC -3'
Posted On2016-11-21