Incidental Mutation 'R5772:Itpkb'
ID445422
Institutional Source Beutler Lab
Gene Symbol Itpkb
Ensembl Gene ENSMUSG00000038855
Gene Nameinositol 1,4,5-trisphosphate 3-kinase B
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.839) question?
Stock #R5772 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location180330485-180424802 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 180334253 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000069851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070181]
PDB Structure
Crystal Structure of the Catalytic and CaM-Binding domains of Inositol 1,4,5-Trisphosphate 3-Kinase B [X-RAY DIFFRACTION]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050581
SMART Domains Protein: ENSMUSP00000050698
Gene: ENSMUSG00000055676

DomainStartEndE-ValueType
Gp_dh_N 2 154 5.53e-95 SMART
Pfam:Gp_dh_C 159 316 5.8e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070181
SMART Domains Protein: ENSMUSP00000069851
Gene: ENSMUSG00000038855

DomainStartEndE-ValueType
low complexity region 68 106 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
low complexity region 302 314 N/A INTRINSIC
low complexity region 595 618 N/A INTRINSIC
Pfam:IPK 722 933 3.5e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195043
Meta Mutation Damage Score 0.0544 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this protein regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. The activity of this encoded protein is responsible for regulating the levels of a large number of inositol polyphosphates that are important in cellular signaling. Both calcium/calmodulin and protein phosphorylation mechanisms control its activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in a block of thymocyte development at the double positive stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,253,988 W238R probably damaging Het
4932416K20Rik G A 8: 104,797,639 noncoding transcript Het
Abcg8 A T 17: 84,686,699 E48V probably damaging Het
Afap1l2 T C 19: 56,922,974 T289A probably benign Het
Atf6 T A 1: 170,747,189 D560V probably damaging Het
Bcl2l14 A T 6: 134,427,399 K183N probably damaging Het
Carmil3 T C 14: 55,493,239 L52P probably damaging Het
Cct3 T A 3: 88,300,967 N61K probably damaging Het
Col18a1 A G 10: 77,166,343 V10A unknown Het
Col26a1 G A 5: 136,847,566 Q67* probably null Het
Cyp2d34 T C 15: 82,617,140 D329G probably null Het
Dchs1 T A 7: 105,773,040 I58F probably damaging Het
Ddx60 T C 8: 61,948,897 L269P probably damaging Het
Dis3l2 G A 1: 86,878,432 G325D probably damaging Het
Dync1h1 A T 12: 110,646,273 K2861* probably null Het
Ednra A G 8: 77,675,067 I198T possibly damaging Het
Ep300 T C 15: 81,639,914 probably benign Het
Fam120a G A 13: 48,880,933 P1068S probably benign Het
Fsip2 A T 2: 82,984,740 M3606L probably benign Het
Gm7713 T C 15: 59,994,643 noncoding transcript Het
Gm9833 A G 3: 10,088,506 R112G probably damaging Het
Gprin3 A T 6: 59,354,413 V303D possibly damaging Het
Hmcn1 A T 1: 150,694,878 V2178D possibly damaging Het
Hoxa11 A G 6: 52,245,400 V107A possibly damaging Het
Iqub C A 6: 24,454,251 M544I possibly damaging Het
Itgb4 A T 11: 115,988,432 probably benign Het
Kalrn A T 16: 33,975,820 V1195E probably damaging Het
Kif12 C A 4: 63,165,941 R608M probably damaging Het
Lcorl A T 5: 45,795,367 probably null Het
Lrrc24 T C 15: 76,722,710 E162G probably damaging Het
Med6 A G 12: 81,579,644 S119P probably damaging Het
Mmab A C 5: 114,436,714 L166R probably damaging Het
Nom1 A G 5: 29,446,875 K737R possibly damaging Het
Obscn T C 11: 59,056,144 S4352G probably damaging Het
Olfr1130 A T 2: 87,608,173 T262S probably benign Het
Olfr1277 A T 2: 111,269,712 Y218* probably null Het
Olfr212 A C 6: 116,515,951 D58A possibly damaging Het
Olfr225 T A 11: 59,613,886 D307E probably benign Het
Pdzrn3 G A 6: 101,172,314 S351L probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Prkdc T A 16: 15,779,388 I2804K possibly damaging Het
Psg28 A G 7: 18,430,715 L24P probably damaging Het
Resp18 A G 1: 75,274,000 V145A possibly damaging Het
Rgl3 T C 9: 21,981,612 M259V probably benign Het
Rhot2 A T 17: 25,839,807 S540T probably benign Het
Ring1 T C 17: 34,022,308 Y278C possibly damaging Het
Rpn2 A G 2: 157,295,345 Y216C probably damaging Het
Scgb2b18 G A 7: 33,173,830 L5F unknown Het
Slamf7 T C 1: 171,639,270 probably null Het
Slc22a12 T C 19: 6,540,449 N237S possibly damaging Het
Spen A T 4: 141,478,184 V1044D unknown Het
Sqor A T 2: 122,809,341 M175L probably benign Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Tarsl2 T G 7: 65,684,125 F632V probably damaging Het
Tln1 A G 4: 43,545,191 V1008A probably benign Het
Tmem145 A G 7: 25,315,614 H554R probably benign Het
Trank1 A T 9: 111,366,676 D1256V possibly damaging Het
Trbv19 A G 6: 41,178,860 Y55C possibly damaging Het
Ttc23l C T 15: 10,551,469 C57Y probably benign Het
Uap1 A T 1: 170,161,380 C158S probably benign Het
Zfp353-ps T A 8: 42,082,610 noncoding transcript Het
Zfp629 T A 7: 127,611,135 I501F probably damaging Het
Zfp820 T C 17: 21,818,721 Y542C probably damaging Het
Other mutations in Itpkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Itpkb APN 1 180332993 missense probably benign
IGL01733:Itpkb APN 1 180333169 missense possibly damaging 0.50
IGL01812:Itpkb APN 1 180420286 missense probably damaging 1.00
IGL01965:Itpkb APN 1 180332405 missense probably damaging 1.00
IGL02447:Itpkb APN 1 180421354 splice site probably benign
IGL03143:Itpkb APN 1 180333368 missense probably benign
IGL03228:Itpkb APN 1 180413999 missense probably damaging 1.00
lahar UTSW 1 180327225 unclassified probably benign
magma UTSW 1 180413975 missense probably damaging 1.00
Purpura UTSW 1 180334096 missense probably damaging 1.00
Pyroclastic UTSW 1 180334253 intron probably benign
volcano UTSW 1 180421315 missense probably damaging 1.00
IGL02991:Itpkb UTSW 1 180327714 unclassified probably benign
R0071:Itpkb UTSW 1 180332765 missense probably damaging 1.00
R0471:Itpkb UTSW 1 180418255 missense probably damaging 0.98
R0616:Itpkb UTSW 1 180421736 missense probably damaging 1.00
R1567:Itpkb UTSW 1 180421858 missense probably benign 0.00
R2060:Itpkb UTSW 1 180421858 missense probably benign 0.00
R2474:Itpkb UTSW 1 180334151 missense probably damaging 1.00
R3022:Itpkb UTSW 1 180418323 missense probably damaging 0.96
R3792:Itpkb UTSW 1 180333173 missense possibly damaging 0.81
R3831:Itpkb UTSW 1 180333695 missense probably benign 0.00
R3833:Itpkb UTSW 1 180333695 missense probably benign 0.00
R3967:Itpkb UTSW 1 180327798 unclassified probably benign
R3968:Itpkb UTSW 1 180327798 unclassified probably benign
R4735:Itpkb UTSW 1 180418215 missense probably damaging 1.00
R4774:Itpkb UTSW 1 180418194 missense probably damaging 1.00
R4807:Itpkb UTSW 1 180334875 intron probably benign
R4895:Itpkb UTSW 1 180413895 missense probably damaging 1.00
R5514:Itpkb UTSW 1 180413909 missense probably damaging 1.00
R5593:Itpkb UTSW 1 180334096 missense probably damaging 1.00
R5633:Itpkb UTSW 1 180327225 unclassified probably benign
R5898:Itpkb UTSW 1 180421315 missense probably damaging 1.00
R5903:Itpkb UTSW 1 180413975 missense probably damaging 1.00
R7060:Itpkb UTSW 1 180333130 missense probably damaging 1.00
X0066:Itpkb UTSW 1 180421780 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTACAGATATGGGTGCTCAGGAG -3'
(R):5'- AACGCATCTCTGCTCACCAG -3'

Sequencing Primer
(F):5'- GAGATCCAAGGAAGCCCTCG -3'
(R):5'- GCTCACCAGCTTTAGAAATTAGG -3'
Posted On2016-11-21